Description :
From Genome Similarity Track
Location :
Scaffold_657:3336- 10594
Transcript NameFunction/comments
Pytve_DAOMBR484snap_masked-pve_contig_657-abinit-gene-0.12Chromosome 14 open reading frame 102
Pytve_DAOMBR484maker-pve_contig_657-fgenesh-gene-0.0Adenine phosphoribosyltransferase

Sequence
7258 bases(100 bases per row)
CCTCCACCATGCTTGGATAGTCGATGCGTACGCGTTGTCCCACATATCCCGCAAGACTTCGAGCCGCTTCTGCTCTTCCAGTCGGTCTTTCATAGCGTAA
AAGCGTTCACGAGTGCGCTTGGCGCGGTATGCTGTCTGCAGCTTCACTGCCGCCTGGGTCTTGTTATCAAACAGGCGGTGCACACGCATACCAAAGCAGT
GCATGAACCGCGACCAACGGAAAAACTTGATCAGGACAACAATTGCAGCTCCAGAGCGCTCGCGGCGAATGCGGTCACTTTCAACTTGCTTCATAATGCG
CCGCGACCACATCTGAATCGAAATGGCGGCGTGGTATCGAGCGAGGCGGCGGGACCACGCTCGGAGCTCGCTGCGTTTGTGTGCGTATCGGCGAACGCAG
CGAGTAACTACCCGTGCAGCTTGCATCTCTCGAACAAACTCGGCGAATTGAACGCGGAAGACATGGCGTTGATAGCAACGCTGGATCTGCAAACACGCGA
GCGAGAACTGAGCATATCGCCGCATCCGGGTCAGCATCTTGCGGCAGTAAAAGCCTCGCCAGTGTGCCTGGATCGTCGTGGCCGCCAGTTCTATGGTGTG
AGCAGCGGCAGCACGTCTGCCTAGAACTCCGCGTCGCCAACTCTGGATTGTGGTGGCGGCAGCAAACTGCTCGACTGCTCTCTCCTCGGCGATGCATGCT
GTCCACTGACTCCAGCTGCGGGTAACTACAGTGCGGAACCTCCTGCGAGCTCGTTGCATCATCAAGAGAGCGCATTTCCTAGGCGACGAGCAAGAACGTC
CGAGTTAGTGAGTTGACAAGACATTAGTGGTATCGAAAACTAGAAACGCACAGGCGGCAGTAGACACGGACACGTTCTTGACATTGTGCCCAGCAGGCCT
GGCCAATCCAATGGCGAATGCGCACACGGAGAACGCGTTCGTGGTGTGCTTGAATCAATATCTGCCACTCACAGCGAGGTGAAAACAAGAAGCACTCTCT
TCGTAGAAAGATTGAATACGCACTGCCAGCTTCTCGGCGCCAAATCTCTTGCGAAGCACAGACGACAGCGGCGAGTTTGCCAACTCGGCCGCACAGTGAT
CACGCAGATAGCTTGCCGTTGATGCAACTATAAGAGCCAAAAGTGCAGTCAGCATCGCTCATGTTCGCAAGACCATAACACCACAATTAGGCTTACCGAT
CCCGTCATGAGACGACCGACGAGATGCATTCGACCGCGATTGGACGACCAAGGGAGTAGCTCCGCCGTTACCGTGAGCCGGCCATGCTTTCCCACGCCGC
CTTGGTTCTCTGGAGAAGTCTGGGAGAGCCGTAGAAGCTCGATGTCCACCGCGGCCCTCTGACAGCAGTGTGTTTTGCGCAGGCACTGGTAGACGCATGA
TCACGGTTGGTTGGTTGACATCTTCCACTGTGTTTGGCCGACAGAATGCCTTCTGGCGAAGCCACACATTGCGGCTCAGCATTGTCGAAATTGATCGCCG
TGATCGCCTTGGAGTTTGACACTCGAAATCAATTGCTCGCAGCGACTCGAGAGTCATTTCCAGCTCCATCACTTGGTCGTAAGACAGCATGGAGTGGCGC
AGCAGTCGAGCGCTCTCCAAAATGCGAACAACGTTCTCATGGACCAACAGAAACAGAGAGTCCTCTCGAGAGAGTTCCTGACGATGATGCTTCGAGTCCC
ACAGCAATAATGCGAGGTCTGGATTGTTCGCATCAATCAGTTTGTGGCGTGCCAGTCGCGCTGGTGGAGACGCTGGCATTTGCTCGACCGGTGACCCTGG
ATGATGTCGCGGTGAAATAGACTGCAACGGAATTGCGTGGCAAACGCGCCGCTTTCGTCGAGATCTAGGCGGTGGTGGAGAACTCACACCGTTTGTGCTG
ACACCACGTCGAGACGCAGCTTGAGCCGATCGTTCATCGGAATGGTTTCCCCCATACTGGACCAACTCAGACGCTCGAAGGTAGCTCTTCTGCTCGGGGA
AGACGTCATCTAGAATAGAGCCGGCTCCAGCTCGTGCAGCCGAGCTGATAGGAAGAAGGCGATCAAGCGGGTCAGCTCGGCCACTGTTCTTGTGCCCACT
GATCGCCATCGCAAGCATGACCAGCTCCAGACCGCGCCACCAGCCATAGACTAACCGAATTGCAATCTGCCAGAAATAGTTGCCAAGTACCGGTACTCTC
CAAAATGTTTATCGATTTACGGTGATCATACCCATGCAGATTCTCATGGAGGCAATCCTGCGTTTCGTATGGGAGACCAAGAGTATCTATCAGTCGTTCC
GTCATGCTGACTGATATCACTACTGAATCACAATGGCTCACACTTCGACTCGAACGTGAAGCTCCTTGGCCGCCATAAAGTCCACAAGCTCCTGACACTC
GACCTCGTTCAAGTATGGACGAAGCAGGCGGATGCCGTCCAGATACAGCTCCTTGCTCCACGGGGCTCGCGCCAACGCGCGGTAGAAGATCTTCTTGGCC
GCATCCACTTTGCCGAGAGCCACTTCGAAGCGCAGATAGAGGCGCCACCCCAGCGCATTCCCGCGAGTGCGAACCCGGCTCACCATGCTCTCGAAGACCG
CTCGAATGCGTGCAATGCCTGGCGTATTCATCCCCCACCTGTGCGAGAGACAGCATGCTGAGTCTCCCGCGTCCTTGGCTTCGTCCATCTCTGGCCCAGA
TCCACCGCTCGCGATACGTTCAACGCGAGCGACCTCGGTTAACAGTGTGAATAGCCACTCGATCAGCTCTGGAGAATCAAAATGACGCCGCCACTGCTTC
TCGACACGGAAAAAATGCTGTCGGAGTGGTTGAGACATCGTCGAACCTGTTTCAGCATCGACAAACAGCCGAAGAAGCAGAGTGTCGCCAGGCAGCGCTT
CCACAGCTTGACCAACAGCTGAGCGCCATTGTCGAGGGCTTACAGCCGGGAACGCACAATGGCTCTGGTGTTGTTGAATCAGCTCCAGATAGCTGAGCCA
TATCCAGCGTGACTTCAAGCACAGACACTTCGTGCTGGCGTTGTTGTCCAATGCTCTGCGATACGCTTCAGTTGCAGCTTCGATGCCCCGGGAGCAGTAG
AGAAGTAGCGCGAGGTTGTGTAAACAAAAGCCAGCGACACATGTCGAACTCTCTCTTGATGCTTCCATGTCGCTGTTGTGATCGTGCTGGACGCAGAGAC
GGATAGCATCATCCAGCTCCTCGCGATATCTCGCCTCAAGCAGCGATACTTGTACAGTTTGCTCAAGGTACCGTTTCAGACCCTCCCAATCCTTCCGATA
CGACTTGACCAGAGCCTCGAGGGGTTCGTGGGTTGATTGCCAAGGGCTCCATAGCACGTACAGAGCTCGCGACCTGGACAAATTCGCGGCCGTTCGCTTC
CTTCGCGCCGGTATTGATCCCCACGCCTCTTGTCGTGCTCGCAGGAACACAAGTCGATGAAACTCGCGGTCAACGAGACCGTTTGACTCGTTTCGAACGG
ATTGAAGCGTCTTCTCGAAGATGCGCTCAACTTGGCGGTCGTTGCCAAGACGAGATTCCATTTTGGCGTATTCGAACAGCACCGGGATATCCGTTTCCGT
GGTGCTTGCTTGACGGGCTAACAGGTGCTGACTGAGCGAGCGTGCAAACACCAAGCTGGCCTCCTTGCTCGAACTGCGCGCAGCAACCTCGTCTTCAAAG
CCAATCCACATCTGCTTAATCGTGCTAGGCTGGACCGGTGGGGACTCTTTTGCCTTGCTTGGCGACTCGATCCGACAAAGAGATTGTGCAAAAATGTGTC
GAATAAACGCGATTTTGCTGCGATCGCATACCGTCGTCTCCTGCACGCGGACCGTCGCAAGTAGTTCCTGGCTCAGCAGCTCTCTTCGCCTTTGAGCAGA
TAGCGATAGCGGCTTGTAACGTCGCGGTTCGAAGGAACTGAACAGCGGTTCGGCAAGCACTTCGCAGTCCGCAGCCTTGTCAGCATACAGCGAGTGGCCT
CTTCGATGTCTCAAGTGCACACCGCACGTCTCGAGCAACGTACAGATGACATCCCATTCGAACCGAGGAGGGACAACAAACAAGAACGGCTGGATCTCAT
CGGTCATGACTGCGCGCTCAGGCTCTGCTTCAATCAGATCCTGGTGATCGATACGCGCAGGCCAGAGGGGACTCCATTGCGAATATTCTTGTCGTTCTTC
ATCCATAAGCCACGACACAAAAGGATCATCAGCGGCCACACGATCATAGTTTGCGCGCTGATCCTCAAGAGTCGTCACGGTCGCGACGAACGATGTCCGT
CGCTTGTCATCTTTCTGTGCAAGCTGTGCTTGTCTCGCTATCGATGATTCTCTGCCGCGAAGCTCCGATAAGATGCGCTCGTACTCCTCCGCATCATCGG
CGTCGTCGACAAGAATTCGCCGCCCATGCAAGTTGCTGTACACCATTCGCCCGCCATTGCCTCCATCTGATCCATCATTCACAGTTTCAGCATTTGTCCT
GTCGATCCCATCATCGCTGTCTTTCAAGCGATTTGCTCGTCGCTGATAAGCGGCAGACGACGCGAGCAGTAGGCGCTTGTGCTCTGCTGATCGAATCGTG
TCAGGCGGATTGATACTGTCAATCTGCGTAACAAATTTGAGCTCAAGCAAGTCGCTCAACTCCGACTGTTGCGGCAAAGTCCCGTCCTCGAGCAGCTGCT
TCAAATCGTTGTCTTGAAGAACACCTTCTTCGCCAAAATGCGGGTCATTGCGGCTCCACATACCTACAAACTCATCGATAAGCTCCTGATGTGGACGAAT
GCCGCTCGAACGTGACGATCGACGAGTGATTTTGGTGGTAAAGTCCACGAGTCCTTGCAACTGGGCAATGGCGTGCTCGGTATGTCCGGTCTTGGTCTCA
AAGCTGCACATGAGCGCATGGAAACGCACAAGTAACGCGGATATCTGCACAGTAAGCGCTTGGTCCGCTGAATGTTCAAGCTCCTTCCTCAGCACTGCAA
TGATCCGAGCAAACAGGTTGCGGATCGAAAGGACTGTAAAGTTTCCAAAGTGCTGCTGATGACACTCGATCAGCTTGATCCACAGTTCCTTGTTGGTTGG
GTCGCGATCGATGAGATCTTCTAACAGCCTCTGAGTCGTGTCAAAGTCATCGATCGCTCCAGTGTTGTTGGTCAAGCCCGCGTGCAGCGTCAGATTAATA
CGCAGCCGCTGCAGTTCGCGTGAATCAGGGTTTGCTGCAAGCGCACGGTTCAAAATGGCCGCTTGTTTGTCGATCATCGCTTTGTGCGCAGCGGCACGAG
CCTTCTTGTCCTTATCCGACAACAACAGCGACTGCTCCTGAAACACGATCAAGTCTAGCCATGCATCAACATCACGCGGATTCTCTGCAACCGAGGCGTT
CAATGCCTTGGCTCGCGACACCAGGTATTGCTCCGTATTCTGTGCATCAGTCAGAAGGACCGAGCCAGGACTCGCATCAGTTTCACCTTCAGCGCTGTCC
TCAGTCGCGAGCAATGCCTCAGAGTTAATGACGGGGTCTAACGGGATGAACGACATTTCACTGGAGGTCGCCGATGCTTGGTCTTGACGCTGCCGAGCAA
CCCTCTTCTCTGAGTAGGCGAGGTACAGGCGCTTCTGCTGCCCAGAGCGCTCGAGTTTGCGCGCTTCCGTCCCGAAATACCGACCTTGTAGAGGATCTCG
AGATTGTTCACGTCTAGGGTGTGTCGGTGGTCTTCGTACTGGCACGACCCATTCGCCGGTGAGTAGATTTCGTCGACTTCCAAGCTCATATATCGGCTGA
TCGGACGCGTAGGTGGACCCGAAGAACCGGTTGTCGCGGTCGCCCGCTCGGTCAAACTCAAACAGCTTTTCATCGCTCTCTGCGCGTCCCACAATCGCAA
TGTCTTGGTTTCTTGGTTGAATGTCCACAGTCGCCAATTGTGCGTCCTTCGACCTCCGGGACACCGACCTTGAGCGCGACCTGTCTCTTCGGTGACGACG
ACGATGACGATGTCGCCGACCGTGCTCGTCGTCAGAGGTGCTGCTATCGCGCGACGACTCGCTCCGCGATCTTCGATGCCTTTTCCGCTTCAAGTGGTGC
TTCTTGTGGACTACAAGCGCGTCGGACGTTCTGCCTCTGCTGTGGCCGTCGCTTTCATCGCGCCGCTTCAGCTTCCGTCCATGGCGGTCGTCGTCTTTGG
ATCTATGGTGATGTTTGTGCCTCTTCTCCTTGCGCGGCTTGGCCAACTGCAAGTTGCCACTACTGCGGTCGCCTGCGGTTGGCTTGCCGAAACTCTTGCC
GATCTGAAGCCAGTCTGCGCGCACCAAGACGAGTCAGCACGAGTCAGCAACCGCACACTAATGGCAGATAATGCTACCATTCGCAGAGATGCTGGCAGCT
CACCTTCGTCACCGTGGCGCTCGTCAGACGCCGCCGAGCTGTTGGCATCTGCAGCACCTGCTCTTCCTGCCGCGAACATTGCTCTTCGAGTTTTGTAACC
CAATCAAGATATCGGGTATGATCTCAATGATTATACAACATAACCGCCACATTCTCGCATTCAGGAAAAGTTTGGTCAAACGGGTGATGATTAGACGAAA
CGATGCAGCGCCGCGCGCTCATAGGCCAGAATTCCATTTGCTGTCTGCTGGATACTCGCAACAACAACTGAAGCATGAGCACGGGCGATGTCGCGGCGCC
GCCGGCCGACGTGGCGGACGCGGAGCAGGTCGCGGCGTACCTGAAGCACAAGATCAGCGCGTTCCCGATCGCGGTCATGAGCCGCGTGGACTTTGTGGAC
GTTTCGCCGCTGCTGCTGGACCCGGCGGCGTTCCAGTTCGCGATCAACGCGCTCGTGCACCGGTACGCGGCCATGGACGTGACCCACATTGTGAGCTGCG
AGTCGCGCGGGTTCATCTTTGGCGCACCCGTGGCGCTGGCGCTCAAGGCCGCGTTCGTGCCCGTGCGCCGTGCGCGCAAGATCCCGAGCAGCACGGTGGG
CATCGACTACACGTCTGGTTTCTACTCGGGCCGGCTCGAGATGCAGGCGGAGGCCATTCCCGCCGGTGCGCGCGTCGTCATCATCGACGATTTCGTTGCC
ACGGTTAGTACGCTCGGGTTGTGGTTGCGGAGGCTGGACTGACAGGGACTGACTGCGGATCGATGTGCCACAGGGCAACACGTTGAAGGTGATCGGCGAG
CTGATTCAGCTGGTCGGGGGCCATCCTGTCGAGTGCGGGTGCGTCATTAGCTCGGCGC