Description :
From Genome Similarity Track
Location :
Scaffold_68:333553- 340288
Transcript NameFunction/comments
Hyaar_Emoy2807751conserved unknown protein
Hyaar_Emoy2807752hypothetical protein

Sequence
6735 bases(100 bases per row)
ACTTCTTCGCGCCTTCAATCTCTCGACCAGGAGGCACCAACAGTCGAACGGGCGAGCACGAACTGCAGATATGCTGCCCACATAGACGACTACAACAACA
CCACCACCAACAACAACAATAACAGCAACAACAACAACAAGATCACAAAAGACATTGTCAGCTCACCCATCCACCACATCACATCCCATCTCTCTCCTTT
AACCTCAAAGCTCCTCAACTCACCACAGATGTCGTCGCTTCGTCACGTCAAAGCGCACGTTGCACACGTCACAGTTCGGATGGTCCGCGTACCGATTGTT
CAGCAGCCCCTTCTTCGTCAAAGTTCCAGCGTCTGACTCGGTCATGCTCGAGTTCCGCTGCACAAGAGTCTGCGACGGGCGTTGCCCCGCACTGCTGCTG
CTATCACGGAAGCTCGAGCTCGAGCTCCTGCTATTGTTATTGTTAGTAAAACTGTTACTCCTGCTATTATCAGGTCCCAGCCGTTGCTGGACGGCATTAA
ACTCCACGAGCTCCTTCCTCCGCTCGTCATCCGGCACCAATCGCGCCAACGTCGGGACGAACGCGCTCGTGCCTTGGGCGCCGAGCTCGGCAACAATCGA
TGCGTAGAAGCGCTCGACCGTGATCTCCTTAAGTCCGAACTGGCGGCAATTGTGCTTGAACTCCTTGACCCCGCGGTCATTGAGTCCGCCTTTGGCTGCT
CGGATCGTCTGCACGCACTGCTCATAGAGCTTCAGGGCGTCAGCTCCGGTTGCTGCTGGTGGTACCACGTCACAAGGAGCGGAAGACTCGATAGAGGAGC
TGCTGGTGGAGGCGAACCGCACGGTAGTGCGGACATTGCCGCTTGGTTTGCTGCGATGACGAAGAGCACTAGAGGGGGACAAGGACTTGCCACTGGATGG
CAAAGGAGAAGCGTCTACGGGAGGGAAGGAGAATTTTGGAGCCATAGGTGGCGAGTTCTTGTGGCTGGTACTAGCTGGAGTATGCTGGTACGCGTGGCTG
CCAAAGGCGGACTGAGGGGTGCGGAAAGCGGAGGCAACAATTGGCGCAATATCGTTGGGGAGAGAGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGCCACGCATACGAGCGTACTCCGGCGAGTACCAG
CGACGCGAACTCGCTACCTATAGATCAGAAATTCCCGTTCCCTCCCGTAGACGCTTCTCCTTTGCCATCCAGTGGCAAGTCCTTGTCGCCCTCTGTTGCT
CTTCGCCATCGCACATTGGTGCAGACTGGAGGCATGACTCCACTTTTCTGAATTGGTTCTGCAATAGTGACAGGAGGAAGAAGACCGAAAACCAACGATT
GGACGGTGAGGAAGGTTTTTGAAAAGTGAGGGGCTCTTTTGGTGATGATGATGATGATGATGATGATTGGGTCGACAGATGGGATGGACTTTGCTGTTTG
GTGTGTGGGGGGGGCGACGGATGGGTACAGTTTACACCAAAGGGCGCGTCATCATGCGACATGTCTCGTTGCGCACCTGAGGAATCGATCCGGTTTAGTT
TTTCTTCTTGATTTTCTTCTTGCTTTTTTGAGGCAAGTGGAACTTGCTGCGATTGATGTTTTGTTATTAATTCTAAGAGTTTAGTACATTTGAGGATTCG
GGGGGAGAGGGGGGTAGCTGTAGACGAATAGGGAGAGGTCGTTGTTGGGTTTTTTCCACAAGTCGGTTTTTATCGTATGTTGAAGCAGCTTTGAAGTCGT
GGATCTTATCTCAGTAGCCAAGCGGATTTTTCGTCAGTGTGACAGCGAGGAAAAAGACAAGTGAGACACAGGATGTGTGTGTCTCAAGCGCAACTTTAGT
TGACGACCACCTGACCTATTGATTTATGTAAAGATGAAGGGCACTGATACCATCAGACTGATATTTTGACAAAGGTAGACAGATCGGACAATATCCAGAC
AATATCCAGCAGATAGCCTCTTCCACACAAAGTCCTGACCAGGGTCTGGCTACTACGTACCACACCATTTCGTTTTATTCAAGCTTAAAGACAGATAGAC
AAATGTAGATAGCTAAACGTAATGTTTGCTGTTCTGGCGGAGGTATATGCTCGCGTGCACCTCAGCCAAGTTGACTGCCTTCAAGTGATCGCTCTAGTGC
CCACTCAATTTCACAATGAGCTTCTCCAGTAGAGTACACACCCATTGGTGAGAGAGAAGCTTGTGTGTGAATAGGTACAGCTGGGCAGCATCTTTTGCAT
TCGAAATGGCATTTCTTTAGCTTCGAGCCCCTCATCGCACGTATTCGGGTGGAAGCCAGCGATACAAAGGATTGTGACGCGACAGGAAGCTGTTGGTTGC
CAAAGTACATCATCATTCCGTTTCCTGATAGTACGCGTCATGCTAAAGGCCTTTGTGCCGGAAGTTTGTGCCTTCCTGTAATTGCGGTTTGATCTGTGTC
CAGATACCGCACTCTAGCGTAGGCATCGCGTCGGAAGCGTGGGTCAGAAGATCCTGACAGCTATTGATGGACATATGATCGGATCGGGGCGCAACTTTTG
CATAGGTCAGCTGGCACTGCCCTAGGTGATACTTTCATTCTCAGGCTGTTATGAGCAAGTCTATTTGCCTTCTAGATTCGGGTGAGTCAGAATAGCACAT
CTAAGTAGAGCTTGTTTGCCTGCTAGAATATCAAACTCGTGAGTTTCGTTTGCACATCCTTGGATAAATGTCGACTGGTATACACACTTGATAGCGAGTT
TAGTTGGGCTCATCGTGTCTCGTCCATATGTGGATAGCGAGATTCATGTGATTGATTGACAGCGTTGAACCGACTTGGAGCAGTCGTGGTGCTGAAGACT
TCCTACCTCTGGTAGTTAGATTATATGAGAAGACAAAAGGATGTCTTCAGGTAATTGACCCATGCGCAAAGATTTCTTCGCCTCGTAAGCAAAAAACTAG
CACCGCATTCGAGCTGAGCTTGAAGCAAGAGGAATCAAGATCAACTTTACTTGCAAGCATCAACCTTCATAACTGCCACTTACTCCTCTTGTTTACGGTG
ATAAAGGGACCACTTTCGCTCTGAGCATTGTCGTCACTACCCTTCGGGCGCACAGCTGTCACTGATTGACTTATGCCCCCGGAGCAGAATATCAAGCTCG
CCGCTATACTTAATAACAGGAAAGGTCCTGGTAACTATTATTTTTAGCTCCTCATACATAGAATTATGAGCCGAAACGTGTCGCGCAGAGGTCCTATTAA
TTCCTCGTCAATAATAAGAAGTACATCCATGTCAATATGTATATGTGGGTTCTATCCGACTTGAAGAAAGGCCTGTCGTTATGAGTCTGTGTATTTCATA
CGCTCTTCTTCGTCTCAGCCCCACGATAGAGTTCTCATACTTTTTGACAACGTTAGCCTAGCGGTAACTTCGAAGCGGCCATTAAATATACTTTAACAAT
AATCTCCGTTATCGTTCTCATGACAGCATCTAATCGTGATGGGAAGCCTTGCAACTCACAGTGACTTGATGTTCTTAGATTGGTCCCTTTTCATACTAGC
AAAGAGCTCGTTCATATATATCATGTGTAACAATTCCGATGATGCAATCGTCTACCGTAGACCAAATGAGATTCACAACGAACGTACCGGTACATATTGT
GAACACCGCAAGATCAACATCAGCAAAGCAAAGAGAATGGGGATGCATTGCACATCAGCTTCGACCTCGGGTATGTGCGATAGCCCAAGCTATTTGATCG
CAAACGCATGATTTGTGTTGGTGTAACATTAGCATCAAGTTGTAATCCATTTCTTATTGAACTGTAGAATATGACTTCGTCGTGCTTGGCATTCCGCAGA
TGTACGCGGAAATGTTTTTTACAGGTCGCAACACTGTCTAACGTATCTGCTTGTATGTTCATTACCAGACAAAAAACAGGAACAACACGTACGCTCTGAC
GTAATTTACGTTGATCAACTCGAATGACCACGAACCTACAAACTATTGCTCACGAAAGTTTAAATCCATGCAATGAAAATCGACTCCATGAAAGGATTTA
CACACTCTTTAAATGTTCGGATAAGATTTACTTTATTTTGCGGTACCGCATCTGCGCACAGCGTCAACACAAACTACGATACCGACATGAACGGGGCGTT
TCTGTAATAAACGAAATTTATTATGTATATGAATATGGATACGTGTTCAATTCCTTAATGGTATGACACATTAAGTGACGTTATTGATCATTGCGCGTGC
CTTTAGCTACTTGGCACGCGTAAAGGAACCACTGACATGCGAAAAAACACTGGCATCACAGCATACGCATGAGTGACGAAGTTCTTCACACTCATGTTCA
TTAGCTTGTACCACCTCGATAAAACGTAACAATATAAAAATCCACTAGCTTTTTATACAGCTACATCCCTATAAAACTACTGTGGCTCCATTAAGAAATC
CCGCAAGGTCTTCCTCGTCTTCGTTGATACCTCGACTTCGGCTGCTTCTTGTTCCTTCTTCAGTTTTTCGTTCGCTTCCTCTCTCTTCTCTTTCAACAGT
CTTGAATCATCCGCCTTCTTCTGCACCGTGTCTAACGTAGTCCCCGCCGCGTCAACTTTCAAATCTTTCGGAAACTTGCTAAACACCATGAAGTCATCGT
ACACGCCCTGAAAAGGGTTTGGCTTTCCATTGTCGCTTGATTGGTCAAGTTGTAAAGCTGCACGGGCGACGGTGCCACGATCCCGACCACTTGATGTTGC
CTCGTCTACCCAGTGCATGAAAAGTCGACCTTCCACCCATTTAGCTGTAGTCTCAGAGCCTTTAGTCGTTTTTGCTTCGAGAATCATCTTCACAAGAGCA
TCGCTCTCGTAGTTCTCGAGAAGTATTTTAATTAGGGAAGACTGTTGCTCAGTATATATGGAATACTGGTGCCAGATATTTAGCGGGATCGTGATGACGT
TTTTATCTCCACCCAGTTGCAGCTTCTTAAAGATAGCTGCCATTGCATCATCCCTCTTAGGTGAACGTTTACCTTCCTTGATCCATCGCGCGAGCTGCTC
GGATAGCAATCCTTTGGATACTTCGCTTGTTTTGGGATCCTTCAATCCTGCGACTATAATCGTTATCAACTTTTTCTCGCCAAAGAAGCGTTCCATCGTC
TCAAACACGCTCGCTTTTTGATTAGGGTTTGCCTTGTTATGACCGCTCATAAATTTTAACCAAGCCTGGAACCCCGCACTCGCCATTAATTCGCCATCTC
CCTTAAACGACGCCACTTCAAATGCCCCGTTTAGATCCTTTTTTTTCCAGTAGTGCGATAGCATGTTTCTCATGATTTGAGCCGCCTCGGTCTTTCCTTC
TCCAAGCAGCTGCATCAGATCTGAATAGCTGAGATGTCCTGTCACCGCCGTAAGCATGATCAGTCCAGATTCTCCCTGGTTTTCGCTCTGCATATTAATG
AAGGCGAGCCATCTGGCAAACGAAGCGTGTTTTGCGTCGACGGTCCTTGCCTCATGTAGCCCAAAAGCCACGAACACATCGAGCGAAGATTTCTTAGCAG
CCACCCACTCGGTATACAACATAGAGAAAATGCGGTCCGCTACGTCGCCCCCCTTCACTTTTACAAGCTTTCTCAACAGCTCATCTTCCTTGTAATATTT
CCTCAGCGTAGTCAGCATTGCTTTCTCGGGTTCGTGTTGTATGACACTTATCGTGTACGAAGCCCACATGATGAAGTCCTCGCTGTCGAAATTCTTCCTG
GGCTTGTGTAAGCCAAACCTCTTGAACACGTGGTCGGGTGACTTTTCTTGGCTGATCCAGCTACACAGCTTTCCCAGAGTCACCTTCGACTGAAAAGATT
GCTGGAGTTTCTCGATCCCCAAAAACCCTTTGAAGTTGAAGATCCTCTCATCTTCTTCGTCCTCGTCCACGGGATCGCCATCCTTGACGCTTTGACCCGA
ATGCGCTTCGGCCGGGTTCGCAGAAGTGATACCATTTGGCTCCAACGAGGTTAAACTGACCGGGTTCGAGTGCAATTGAGCATTCGAAGAAGCAAGCAGC
GCGACTGCACCAAAGAGGAGGACACCAGGAAGGTGCATAACGGTTTCTTGTCCCTGCCCTGCGTAGCGAGAAGCAAATTGCAGTGATACGGTGCAAAACG
TTGCATGCTCTACACCAGATGCTAGGAGAACGGCCAAAACGACTGAACGGCAGAGGACGGTATTGGGGTTGTGTAATGTGCTCAAATCACACAGCTCATC
CTGAAGGCCGCCGGCTTGACCTTTGTTTCGAACAAGGAGATCAAGTCATGCGTGGCACATGGATTTACTTCCGACATGTTAGTTGACACTAGCCCAGAAG
AGGTTGACATGTATACCAAGCAACGCCATGTCGTTGAGATCGCCACCGCTTTGTATTTGCGGAAAGGATTGCTCGCGCATGTGAGACTAGTCTAGCATGT
CCTCGTGCATCTATGTACCATTAATCGGCATCTTC