Description :
From Genome Similarity Track
Location :
scaffold_25:333542- 334650
Sequence
1108 bases(100 bases per row)
ACTCAGCACTAGCTGTTGCCAAAGGTACAAGTCAGCGATTGGCGAGCTATTTACACAGCGACAGAAGGCTTGTCATGTGcgcgagagcaagtctccgcaT
TGTAGTCCAACCTTCTGTGTGAAGAAAGCCACATGTGGCTGGcgcattgttcacgctttcaacaaattgagcGATGCGACTATACCATCCCGGACTCCAG
TTCCACGCACGCAAGTTTAAATTTTTCACTGGAATGATTGGCAGTACTGCTCCTATTGCGGTCGACCTGATAGACGGTTTCTATAAGATACGAATGTGCG
AAAATGAAGCACCACTAACTGCAGTCAATTCTCAGTACTACGTTTTTCCCGCTTCCAGCCTATTTACACCCATTCTAGACTTCATTTCCTCCCACACTCA
ATATAGTGGTATGTTGTGGAAATGGTTAATGATGCCACAACGTTAAAGTAACGCTCTTGCGACTTTCAACAGAAAGGTCATGAGTCTTCTTTGTCCATTG
AGAGAATTTGCACCGAATTAGTTTGACGATACATTCTTTCATAGTACGGAACGAGTAAGAAGTCTGATGTCGATGTTCGTCttgatcatcttcgtcaagt
cTTACGGGTTATGCGAGAGAATAAACTTTACGCTAACATGAAAAGGTACATTTCTCTGTACCCTAAATTCCCGTTCTTGGCTGTTTCGTGGGCAAGAATA
CGTTCGTGTTGATCCGGGAGGAAGTCAAAGCTATCATGCGTCAAACAGTTTGAAACAGCTGAGTGGGCTTTACCGACGATTTGTACAATTACACGAGCAA
TTATGCAGAGTTAATGCAACCCCGAACGACTCTTTTAAGAAAAACGCTAAATGAGAATCCAGCGGAACGAAATTATCCAGTTCCTAACAAAGAGATTCTT
GCAATAAAGTATCATTTGGTTAAGTTTCGTGTGAAGTTGCTTAGAGAGGAgcgctttgcgatctatacagatcatgtcTAGCTACGTACGGAAGTAGAGA
CTCCTCATTTATCGCAGAGATGGTTTTCGGAGTAAGCTTTGCTGTACGCTATAAGCCAGGCAAGACGATCATCttgactgatgcgttgtcaagacGTTTG
GACAATGA