Description :
From Genome Similarity Track
Location :
contig_38:333443- 335860
Transcript NameFunction/comments
g8383.t1XP_009515465.1 hypothetical protein PHYSODRAFT_353490 [Phytophthora sojae
g8384.t1hypothetical protein

Sequence
2417 bases(100 bases per row)
GACGGCCGAACTGAACCAGCAGTATGTTGTTCTGGATTCGCAGACCATCCAGAACCTGGAAGTGCTTACCAACACTTTAACGGCACGCGGTCAGGATCTC
TCATCGATATCATGGACAAGACTGTAACGAGTTTTGGCCGTCGAATGTTCCAGGAGTGGGTTTTAAAGCCGCTGTGTAAGATTGGGGATATTCAAGAGCG
CCTCGATGCCGTTGAAGAGCTCGGCAATAGTGGTGACTTGATGATGGAGATTCGCGAGTTTCTCCGCAAATTGCCGGACTTGGAACGACTACTATCTAGA
ATTCACGCGCTTGGATCTTCGCATCGCTCAAAGGAACACCCGGATAGCAGGGCAATCATGTACGAGTCTCAGACGTACAACATCCGAAAGATTCGAGACT
TCCTTGCCGTACTAGATGGATTTGATGCGGCGATGAACCTAACGCTTGAATTGGGGCCTCGCCTCTCTCAATCCACTTCGCCAATTCTTCAGTCACTGCT
GAAGAGATACCAAGTCGAGGACGGTGTGAAGCCGGATATTGAGCACGGACATTTCCCCGACCTGACGGAGAAACTTGAGTTCTTCAAGCGCAGCTTCGAT
CAAGCTGCTGCACAGAAAAGCGGTGTAATCGTACCCCAGGATGGTGTGGACTCAGAATTTGACGATGCTTGTGCTGAAATCGCCCAGGTTGAAGCCGAAC
TAAACGAGTATTTACAAGAGCAGCAAAACGCGCTGCGATGCCGTCAAATTTCCTACTGGATCCCGAAGAAGAAGGAGGATCGCTATCAGTTGGAAGTTCC
TGAGAGCGTGTTATCGAAACAGCCGAAAGAGTTTGAACTCAAGTCGCGCAGGAAGGGTTATAAACGTTTTCACACGCCCACAATTCGCAGCCTGCTAAAA
CGGTTGGCCACTGCCGAGGACCACAAGGATGAAGCACTCAAAGACCAAACGCGCCGCATTTTCCACAAGTTTGATGAAGACTACAAGTACTGGATGAAGG
CGGTACAGTGCTTGGCCGTGATTGACTGTTTGGTCAGTCTCGCGCTCCTCAGCAGCCAGAGTGAAGGCTACACGAAACCCGAAGTGGTGGCGGCTATCAC
CGCGAACGGAGGAACCCCTTTCGTTGATATTGAAGAGGGTGTACACCCATGCGTTGCCGCAACTTACGGCAGCGGGGATTTCATCCCGAATGACGCACGC
CTCGGAATCGAAGGAAAGGGTCAAATGGTTCTCCTCAGTGGACCGAACATGGGTGGTAAGTCGACGCTGCTGCGCCAGACGTGCGTTCTCACCCTCATGG
CCCAGATCGGCAGCTTTGTCCCGCAGCGAAATGCCGTCTCAGCCCTGTTGACCGAATTTTCACCCGTATCGGCGCTTCAGATCGTATCCTTGCTGGCCAG
AGTACTCTTTACGTTGAGCTGGCTGAGACGGCGACGATTCTGAATCACGCTACCAGCCACTCGCTTGTGATTTTGGACGAGTTGGGACGTGGCACGTCCA
CGTTCGATGGCACTGCCATCGCGTACTCGGTGGTTGAGCACCTGCTGAGCGATATCCGTTGCCGAGCGATGTTTGCTACTCACTACCATTCGCTGGTCGA
AGAGTATGCGGGCAACGATAAGGTTTCTCTGGGCCACATGGGGTGCATCGTGGACCAAGAGAACGATCGCAAGGTCACGTTCCTGTACAAGCTGGAGGAC
GGCATGTGCCCCAAGAGCTACGGTATCAACGTCGCCATGCTGGCCAAGCTCCCGGACGAAGTGATCGAGTGCGCCGCCAAGAAATCGGAGCAGTTCGAGC
GCTCCTTGCAGGCGAACTCGCACACCGAACTGGAAACCGTCCGACTCGCACAAAAGGTGAAGGAAGCGCTTGCAGAAGGCGAAGCGGGCGTAGGCAAACT
CAAACAGCTATGGGAAGAAGCACGCAGCGCCATTCGCGCCTAACTCGAACAAAAAATGTATCCATCTGACGTACGTGACCTTAATTAGGAAATCATCTGT
GACAGAAATGCGTCAAGTCAAGTCGCTGGTGGAGCTGTCGGTGGTGGCTGCGGCGCTCTCCACGCCCGTACAGGAGCTCCTGGACTATGTGGAGCTCCTG
CCCATCGCCATCCGCCACCAGCTCTTCCGAGAGTTGCCCAACTTCCGACTGCGCGAGATGGAGGTGGCGTGGGAGGCGTCTGTCCAGCTGGGGGAGGCCC
CGGAACCGCGCGACGGCTTCGACCCCCAGGCGGGTGACAAGTTCCTGTTTGACCGAGAGACGCAAGGAGTGTGGGAGCTCCGCATGAACGCAGCAAGACT
GGGCTACGAGCCGATCCCCATCGAGAACACGGCGGCGGCCCAAGGACGCAGACGCAACCACCGGCACATCTTCTGGGAGCACCAGTTCCGCACGTTGCTC
AAGCTGCGCACGCCACT