Description :
From Genome Similarity Track
Location :
contig_38:333401- 335818
Transcript NameFunction/comments
g8768.t1hypothetical protein
g8769.t1RAW41892.1 hypothetical protein PC110_g1930 [Phytophthora cactorum

Sequence
2417 bases(100 bases per row)
ACACGAGATGCTCGAGTAAACAAATCGTTATCCGCTGCGACGGCCGAACTGAACCAGCAGTATGTTGTTCTGGATTCGCAGACCATCCAGAACCTGGAAG
TGCTTACCAACACTTTAACGGCACGCGGTCAGGATCTCTCATCGATATCATGGACAAGACTGTAACGAGTTTTGGCCGTCGAATGTTCCAGGAGTGGGTT
TTAAAGCCGCTGTGTAAGATTGGGGATATTCAAGAGCGCCTCGATGCCGTTGAAGAGCTCGGCAATAGTGGTGACTTGATGATGGAGATTCGCGAGTTTC
TCCGCAAATTGCCGGACTTGGAACGACTACTATCTAGAATTCACGCGCTTGGATCTTCGCATCGCTCAAAGGAACACCCGGATAGCAGGGCAATCATGTA
CGAGTCTCAGACGTACAACATCCGAAAGATTCGAGACTTCCTTGCCGTACTAGATGGATTTGATGCGGCGATGAACCTAACGCTTGAATTGGGGCCTCGC
CTCTCTCAATCCACTTCGCCAATTCTTCAGTCACTGCTGAAGAGATACCAAGTCGAGGACGGTGTGAAGCCGGATATTGAGCACGGACATTTCCCCGACC
TGACGGAGAAACTTGAGTTCTTCAAGCGCAGCTTCGATCAAGCTGCTGCACAGAAAAGCGGTGTAATCGTACCCCAGGATGGTGTGGACTCAGAATTTGA
CGATGCTTGTGCTGAAATCGCCCAGGTTGAAGCCGAACTAAACGAGTATTTACAAGAGCAGCAAAACGCGCTGCGATGCCGTCAAATTTCCTACTGGATC
CCGAAGAAGAAGGAGGATCGCTATCAGTTGGAAGTTCCTGAGAGCGTGTTATCGAAACAGCCGAAAGAGTTTGAACTCAAGTCGCGCAGGAAGGGTTATA
AACGTTTTCACACGCCCACAATTCGCAGCCTGCTAAAACGGTTGGCCACTGCCGAGGACCACAAGGATGAAGCACTCAAAGACCAAACGCGCCGCATTTT
CCACAAGTTTGATGAAGACTACAAGTACTGGATGAAGGCGGTGCAGTGCTTGGCCGTGATTGACTGTTTGGTCAGTCTCGCGCTCCTCAGCAGCCAGAGT
GAAGGCTACACGAAACCCGAAGTGGTGGCGGCTATCACCGCGAACGGAGGAACCCCTTTCGTTGATATTGAAGAGGGTGTACACCCATGCGTTGCCGCAA
CTTACGGCAGCGGGGATTTCATCCCGAATGACGCACGCCTCGGAATCGAAGGAAAGGGTCAAATGGTTCTCCTCAGTGGACCGAACATGGGTGGTAAGTC
GACGCTGCTGCGCCAGACGTGCGTTCTCACCCTCATGGCCCAGATCGGCAGCTTTGTCCCGCAGCGAAATGCCGTCTCAGCCCTGTTGACCGAATTTTCA
CCCGTATCGGCGCTTCAGATCGTATCCTTGCTGGCCAGAGTACTCTTTACGTTGAGCTGGCTGAGACGGCGACGATTCTGAATCACGCTACCAGCCACTC
GCTTGTGATTTTGGACGAGTTGGGACGTGGCACGTCCACGTTCGATGGCACTGCCATCGCGTACTCGGTGGTTGAGCACCTGCTGAGCGATATCCGTTGC
CGAGCGATGTTTGCTACTCACTACCATTCGCTGGTCGAAGAGTATGCGGGCAACGATAAGGTTTCTCTGGGCCACATGGGGTGCATCGTGGACCAAGAGA
ACGAGCGCAAGGTCACGTTCCTGTACAAGCTGGAGGACGGCATGTGCCCCAAGAGCTACGGTATCAACGTCGCCATGCTGGCCAAGCTCCCGGACGAAGT
GATCGAGTGCGCCGCCAAGAAATCGGAGCAGTTCGAGCGCTCCTTGCAGGCGAACTCGCACACCGAACTGGAAACCGTCCGACTCGCACAAAAGGTGAAG
GAAGCGCTTGCAGAAGGCGAAGCGGGCGTAGGCAAACTCAAACAGCTATGGGAAGAAGCACGCAGCGCCATTCGCGCCTAACTCGAACAAAAAATGTATC
CATCTGACGTACGTGACCTTAATTAGGAAATCATCTGTGACAGAAATGCGTCAAGTCAAGTCGCTGGTGGAGCTGTCGGTGGTGGCTGCGGCGCTCTCCA
CGCCCGTACAGGAGCTCCTGGACTATGTGGAGCTCCTGCCCATCGCCATCCGCCACCAGCTCTTCCGAGAGTTGCCCAACTTCCGACTGCGCGAGATGGA
GGTGGCGTGGGAGGCGTCTGTCCAGCTGGGGGAGGCCCCGGAACCGCGCGACGGCTTCGACCCCCAGGCGGGTGACAAGTTCCTGTTTGACCGAGAGACG
CAAGGAGTGTGGGAGCTCCGCATGAACGCAGCAAGACTGGGCTACGAGCCGATCCCCATCGAGAACACGGCGGCGGCCCAAGGACGCAGACGCAACCACC
GGCACATCTTCTGGGAG