Description :
From Genome Similarity Track
Location :
Scaffold_1115:3334- 8458
Transcript NameFunction/comments
g10627.t1ETI30235.1 hypothetical protein F443_22644, partial [Phytophthora parasitica P1569
g10628.t1hypothetical protein

Sequence
5124 bases(100 bases per row)
TACGCTTCTCGGTTCTAACAACGACACCCGTTGCTAGTCTCACTTCCAATAGACTTCGAGGTGTTTCTACCTCCTCGAAGTCAAGCCTTGGAAGGCTCTG
CAGTCGAACAAAGTTGTTCGACGCTCCACAGTCCACTAGAGCACGAAGAGATCTCTCTCATCGAGCTTACCTTCAGGATGACAAGGTTCGGCTTGTCATC
TTGCTTCTTGCAGTGAAATTGACTCTCACTGGGGGCAGCGATCTTCATTGCAGCGTGTCCGATGTCGACACGCTCGATCGCATCACCAGCAGGGCGCCCC
GCGCCTGCTGGTCCCTTTAGTTTTTTGATTGCCCGTGACGATACCCAGTATCGCCACGACGGCTCCTCGCCGCGTGCACAGGTGCTGTGCACTCGCGGGC
ATAGTGACCGATGTTTCCGCATCGGAAACAACGCACATTCGTTGATACACGACGCTGCTGGGAACCAGCAGCGGTCGCACTCGAGAGGTCCATTGGTTCG
GGACCTCCCGACGGCCTTACCACCGGTCGTGGCATTAGCCGCGGGACGTTCACATGCAGTTTAGCCTGCCGTAGGCTAAACGCTTCTTGCATTGCGGGCG
CAATTGCAGCCTCGAGAGTATTTGGATACTCTCGGAAGAGATAGGTCTTCACAGGCCCATCTCTAAGGCCTTTCATGAACGTGACGACCTTTGTCGCCTC
GTCAATCGGGTTGGTCACAATGTTCGAGACCAAGTACCGTGCCCTTTGGGCGTAAGCATGCACGTCATGCTTGCCCTGTTGCAGATCGAGGAACTCCGCC
CTCGATCGGAACTCGTTCTGCGGGGGCTCAAACGCTAGTTTGAGCTCCTCCTTGAAATCCTCGTACGTGCTAAAGCACGTAGGATCTGTGAGTCGGCGTC
CGTACGCCCAACTCCTCGCTCGTCCGCCAAGACATGACATGGCGAACGCAACCTTCGACAACGGGTCGACGATACGTCGAGCCGCAATGGCAGTGTCGAC
CTCGACAAGCCAACGGAGGAGAGGTTCGCCCTCTCTTCCAACGTAGCTGCTTACGTGGAGTTTTAATGACTCCACGCGCGGTGTGGCCGATGGCGACACC
GAAGTTCGAGCAGCGGTTTCACGCTGTTCCTTCACGATGAAACCCAGAGCAACACCGTGTTGCTCCGTCGGCGATAGCGTTCGCAACATCGTTGCTACCG
CCGCTTCCCCAATGACTGTTGACAGTCGTTGGAGGGCCTCCCACTCTGGTTCCGACAGGTGGGGGCAGTCTGCATGCGCAACATGCGTTGCAGACGTGTT
TGGGCTACCCACGGACATGTTACTGTCCGAGGGCAGGTTCTCAGCCCCGCGTTCGTATTCCATACGAACGTGTTAGTCGGTCGTTGGACGGACTACAAAG
TGCTACCAGGTGTAATGGGTCTGCTTAGACCCACTACTAAGCTTACACGTGTGCGCACGTGTATGAGGAAGCGTAGGAGTAATTTACTTAAGTTCAGTAT
ACTTGTATCCGCAAGTATACTTAAACCTAGATAAAGGAACCGAACGATAGCTTTGGAGCCAAATGAGAACTGTATTGATTGTAAATGGGGTTTCCTCCTA
AAACTGATATTTCTAATGAGAGTTTCTGCCATTGGATGGCTGGCAGAACCCCTATCTATTGAATGACTCTCATTGGTAGAAAGGTGTTACTTTCTACCAG
TCATATGCCTTTTGCTATGAATGTGGACCACCCTGTGGAGTGGTCACCTGAATGTATCCATTAGTGCATGTTGCACTAAGGTAGGAGGTGAACCGAATGT
GTAGCCCCGCTACAGTACATGCCGCGGTGCGTGACGAAGGTGAAATACTCCTGTGAATCCGGGTGCCACGGCAATTGCCAGTAGCCCCTAAACCAGTCTA
AGCTGAAGAAACCTGTGGTACCTTCGAGCTCGCCAATAATGAACTACAGTATAGACATTGGCCACGGCATCGCTTCCGTTCTGTCGTTAACAGCGCGCGT
GTCGACAGTAATTCTCGGGTAAGCGGTTGGGTCCGTGTCCTGCTCTTTTTTGCGCACAATCCTTGGCGCGGACGCCTAGCGGCTCCTCGAGTTCCGGTAA
GCAAGTCCTGTGGCAAGCAGCTTGCCAACATGTCGCTTTAAGAACTCACGGTCCAACGGCGGTGCTCGTCGCGCGTGCGCTCTGGTCGGCGCCACGCCCA
GCTTCAAGCGCACATTTAGCGGCGCAAACTCCACAGGCGGACCGTTTCCAAACTCCAATCGGAAAGTGTCCAGCCGGACCTGTAAAATCCGTCGCAGGCG
TGGCTGCAAATCTTTGCATAACCCTGCAGACGCGGCATCTTCCGCGCGTTTCTCCAACATTGCGATCACGTCGTCCAACGTCTTTTTAGTCAGTGTCGGC
ATCGCTGGTCTCGACTCATATCACTCCTCGGCGTCATCGAGCGCAGTCGGAGGTGGGGCTAGTGCAGATTCCTGCAGTCGGCAGACGCAACCGAGAGCGG
TCGGCTCGCCATCATTTCCGGGAACAGCCGGTCTAGGTGCCATTCTTGTTCAGTATCGCGGGCACGGACAAGCAGCTCGTCCGTCGAATACCCGAGCACC
TGCATGATGTGGCGGCTCACTGCAAGGTCTAGCGTCGGGTGTCTTCCTCGATATAGCAACTCAAGTTTCGCAGCATAAGCGGACCCGCGGACGTCGTTAG
CTTGACCTCCTTGAACGCAGCCACGCGGGTCACTGAGAGATGCTTACCTCCAACGGGTGTTAGCGACTTTGGCGGGATCGAGCTCACGTCTGCGCCGACC
CCTTTGCTGCGCAACGCGTCCAAGACACCGCGAGCCACAAGCGAGGCATCCGCACCAGAATCCAGCAGCAGTGTCTTGACGGGCACGCCATCCACGGTTG
CGGCAACAATACCGGGATAGTCGTCAGACCTCGGCTGCCTGACAGCTCGAACTTCCTCATTTTGGTCTGGCTGGAGCGCCGACGGTCTCGCATCTCCTTG
AGAAGCTGCCCAGCTTCCGCGGGTGAATCCAACTGGTTGCATGCACGTACCTGATTGGCGGTTGAGCCGCACTTGAGACACGGTCCAGGAGTTCTTGGTG
CCCCTGGTGAACTTGCATGACCAGACCCAGTACCAGAAGGCGCCGGACCGCCGGCGTTCCTGCTGCCACGGCCTTCGAGACCGTTACGACTTCTGCTTCC
GCCACCCGTGCGAGCGCCACCATGACCTTGCGAGCTCGTTCCACGGCTGGCACGGTCTCCACGGCCGCTGTTGTTTCCGCGGGTGTTTCCACCAGTACTG
CGACCGGATTGTGGTAGCCCGTAGGTCAATGATGCACGTTACCACATCATGTACTCTTTTAGCAAGTGCGTGGCCCACGTACAGAACGGGGCCACCTCCT
TCTTGTACTGCTTATTCTCCTGCAACGAGAGTCTCTCCTGCAACGAGAGTCTTCTCGTGACCACGCTCTTGAACGCGGGCGGAACCATCACGTTATGCAG
GTAGGTGACCAAGCGTCGCTGCTCTCTCTCGAACGCAAGCTCTGTCACATTGAACTCGCGAAGGACGTCCCCCAAGTCGGCTTGGAGAGTCGTCATCCGG
CTTTCAGGCTCGGGCAATGTCGTGCTTATACTCAGAGCCTTCATGGCTTCGTCGATGGCTCCATAGTCCACATGACTAGGAGAGTAGGCTTCTTTGAAGT
AGTCGACCCACTGCTGCTCAGTTACGAGGTGTGGGGCGCACGCGAACGTGAACCGCGCGATTTGTCGCTTGGTTCTGCCCTCAATGCACGTTCCGACAGG
CATCACAAGAACGCCCGCTCACTGGGTCTGGAGAGAGTTGATCGCCGACAGGTAGGTCTCGTAGTCAGCCATAAACTTGCGGCGGTTCTTCATGGTGGGC
CCCTTGTAGCGCGGCGGCTGGGATAATGCTGGCGCAGTAGGCGCGCGTTGTTGATCGGAACGAGGACTTGCCGTCTCAATCTATTCGTCAGGTTCGGGGT
ACTTCTCCTCGTCGTCTTGGCCAGCCGACGTGAAGGCTTCGAACGGATTCGGGATCCTCAGACGGAGGGCCCAGGAAGGAGGCGGGTAGGAGGTACTTGA
AGAAGACAGCTACTGCAGCACAGACAAAGTTAGACGTAACCTGCGCTCACAGCGTGGTGCTTACCCGTATGGTCCGCGTCGAACATATTGCTGATGTAGT
GTTCTAGAATTGTAGCTCTAACATCGCCTCGGAACTTGACCGGAGTAGCCGCTGCATCTTCTGGTGTCGTTTGACCTTGACGTGTTCGTGCTCGTATAGA
CAGCTTGTGTCTGCGCATAGAGCGCCGCCTCCAGGAATACGACGCGCTAAACACGTCCGGTGAGAGTCCGTCATCTGCAGCTACCTCTAGCATTTTGATC
TCCAGCATTTTCGCCGAGACCGGACAACCTTCCTTTCGCGTGGAGTTCCTCCACAGCACGATGTCCTCTCCCTGCATCTCTAGACAGAATAGTCACATCA
TCGAGGTTGTGGTAGTTGTGCAAGCGGCCTTTGCCGCTATTGCACACGTCCTGAGTGCAACCTGACTGATGTTTCCACTTCGATATCTACTTTTGCTTCC
TCTTCCTATCTGCCTTGGTGATAGATGGATAGAATTCGTCGAACGCCTGGGTCACCATAGCACCCTCGCCAAGATGATCGAGAATGCGAAGCTTGTGGGT
GTAGTCCACTGGAATGTGTGTATATTTCTTCAGTCGTTTACCAGTCTCGGTAGTGCGAGGTCGGTCCATCGGAGAAATACTTGTGGAATGAGAAGGTGCC
TTCGTCCACCCTCGTTCAGGACGCGAAGCTATTACACAATTAGGTTAAGTTTAGCTCGCTGAATACTGCGAATTATATGGGATTAAGAGGGTATCATATA
ATTATAATTACTTGGTTTCTATTGGCTATTATAAAATTCGCTTAGGACAGGAGCGATACGGTACCCGACTGAACCCTACTGACTGGTTGGGCACAGGGAT
ACGCTGCCGATGAGGCGAGCATACCCAGGATTTGCTAGCGTGTTTCCTCTACATATATGTGTGGTGAGCTGGTAGAACAGCAGTTTACTTCGCTATTCTA
GTTAATTGACACTATCTAGTGGCC