Description :
From Genome Similarity Track
Location :
Scaffold_70:33320- 34625
Transcript NameFunction/comments
Physo_139070hypothetical protein

Sequence
1305 bases(100 bases per row)
GTACGTACACCGCCCACTCCGTTTACCCTTGCTCCAGTCCGTCGGACCATTTGCCACCTGTCCCCGTTGGGTCCATGGGATCAATAGCATCGTCACGCTT
CCGTCTCTTGCTTCCGTGCTGAGCCTGAGAGTTTGCCTGGGTAGATGCCGCGGGCCGCTTAGTGGTCACAGGGTTTGAACGTGCACCAGTTGACACGACT
GGCCGAGACGAAGTCGGTGCAAGGTTGGTACTGGCGTTACTCGATTTTGCATCGGGTCTTGTATTCGTGCTGCTGTCTGTGGGCTTTCCACAGCCTTTCA
GGATGCTGTCGAGTTTTGCTTTCGCCTCCAGAGCTTGGACTATTGCAATCACAAGCGAATAAGTTACGTTAGCGTGCGTTGTATTCAACAATGAACTCGT
CAACAAGAGAAGATCCGGTACTAACCTAACGATACACTCCGCGCTACCGGTCGAGTCCACGTCGTCTCATTTGTCTTTCGATTCCAGTAGTAAACATCCC
CACTAGCTGCGTCAGGTACTTCTTCCCATCCACTACAGCGAAGCGCAAACAATCACGCTACCGTCAATTTCCAAATCATCGCAAAAAACCGCTGGGGTGT
CAGAACTCTATCCTCCACGTACTCGGCTAGTTGGTCTCCAGTCGTCTTGGCACCAGCGCTCTTCTCCGTCGTTTCCTTCATTAAGCATCAAACACGGTCA
TCTCTCTGCCGTCATCCACTGTAAGATAGATCGGAAGTCTCGCTCACCTGCACTGCCGAGCTTCCAGGTCGCTCCCACACCGTCTCATTGGTTGTCTGCA
GCAGAAAGCATCATCAATCGTCTCGAACAACTAGCACCTCTGTATAGCCCTAGCTATTGTTGCCCACCTCGTTCCAATAGTACCGGTCTCCAGACGCCGG
GTCCACCACTTCCTGCCACCCTGGAGGGAGGGCGTTGCGTTCTGTCGAGTGGAAGTCCAGCCTGTAGCTCTCCGTCTTCTGCTCGATCTGCTGCGTCTTC
TGCAGCTCCTGAGCGCGCCTCAAAGCCACTGCATGCAGCGTGTTGTCCCTCACGCGAGGGTCGAGCTTGTCGGCTGCCGACTGCTCCTGCGGCTGCGCGC
CTAGCACGCGACGCTGCGCCACTGCGGAGGTGGCGTTGGCTGTCTGCTTCTGCCTCAGTTGCTGCTGCTGCGCCAGTTCGCGCTGGCTCGGGCCGCTACC
GGTGCTCTGGAGATGCTTGAGCGCTTCGGCACGAGCCTTCTGGGCGGCCAGCTCCTTCTTGAGCCGCTCCGCAGCGACGGCAGACTTTGGCGGCATTGAT
GCCGT