Description :
From Genome Similarity Track
Location :
Scaffold_9:33316- 37263
Transcript NameFunction/comments
Physo_339837AC020646_20 T32E20.30

Sequence
3947 bases(100 bases per row)
GAATTCGTCCACTGACTTGAGTCGTGAAACATGCACCACCAGGTAGAACCGGTATCCACTTCGGTCGGGTAATTCCAACTCATACGCAAACTCGTCGACC
TTCTTCTTCTCGCGGAACGGTCCGTGCCACCGATGGGCTAGTTTCTTGGTCAGTCCTGGTCGAACCCGTTCCATGTACAGCCACACTCTGCTCCCAGGCT
GCAAAGAAAGCCTCGTTCTCGTCACTGTAGCTCCACCATGGTCAGGGGAACTCGATGCTCGGTCGACCGAGGTTCTATTCTCGCCGACGCCTGCCGTAGC
TCCTTCTCCTTCCTTCCAAGTGATGCATTGTGCTCTTCAGCTCTCCGAGCCTATTCCGCGGCTTGGTACTCCTTGGCCATCCTCAGGGCCGTTTCCTGCT
GTCGGTTGACCTCTCGGCGCCATGCTAGCGCGTCAGTTTGACAACCGAAGCCTCGTTTGAGTGACGAGGACATTGCCTTGAGCGTCGACTGTGCATCCCA
CCCATGAACGAGGTAAAATGGAGCTTCCTTCCTCGTCGTATCACGGGAGTTATTGATGGCGAAGATCAGTCTTTCGGCGATCTCGTCCCAATCCTGCTGC
AATGGGTCTTCAGCGTATACGCGGACTGACTGCATGATCGTCTTCATCGATCTCTCCTGCTGGCCGTTGGCCTGCGGTCGGTAGCTCACGGTCGCTCTCG
ACCGAGACTGCATCATTTCTGCGAAGGCTTGGAAGACCTCGCTCATAAATCGAGGATCTCGGTCATGACGGATCAAGGACGGTGCCCCAAAGCGTCGGTA
GACACACTCCTCAAAAGCTTGCGCAACGAGTAAGGCAGTAGTTTCAGACATGGCTTTGCCCATCACGGATCCCGTGAACGAGCATTGGAACAGCAGGAGA
GCCGTGTTGCCACGGCGACTCTTCGGTAGCGGTATCACGAAGTCCATAGAGACTAGTTGGAAGGACCTCTCGGCTAGAATGTTCCCTGGCGAGTACCCGC
GGAACTGAGGTCGGCTCTTACTTGTACTGCAATCAGGGCACGACTTAACGTGTTTCTCCACATCGGCATACTGGACGATCCAGTAATAGTCTCTCGCCGC
TCGATGTAGCGTACGGGTAATACCATGATGACTGCCTTCGAGTGAGTCATGACAGCTCTGCAGGACCTCTTGGATCATCGTTGTGGGTACTACGAGTCTC
ATCTTCAACTCGGCTTGCTCGTCGTCACTTGAACGACGGCTCGTTCTAGTGTAATACAGCACATCGTCCTCGCTCAACACAAATTGGTCCGCCATTTTCC
TTGCATCTCGTGCTGCTCTTTATCCAATCTTCGCGTCATCTCCCCGGAGCACTGCCTTCAGATTCGACCACCGTAACTCTTCATCTTAAGCGGTGGCAAT
TCTCCTTTGGCGTTCTTCCTGTACTACCAGCGGGTCAATGTCTTCCGCGTTCGGTTGGGCTGGTGACATCTCGGCGCGTAGCGGTGAAGCTCCTGCTTCA
TTCTGAAACTCGTTCGGCACACCATTGGCTTCTATTCGGTGAGATGCGTCTCCCTGATCGGTGACCGAAACTTCATCTGCAAACCGGACGTGTTTCTCCT
TTGCTCTCGCTTGTACGTCTGGTCGTCACAGTCACATGTCCGGGTTCAGTCTCGTTCTGCCGTCTGTGGTCGGTTTCTCTTCGCACAAAATCGAAAAAAT
TCTTGCTACGAGGTTTGGCAGAAGCTACCACAGCCCATACTGCGTTGACCGAGGGTATGTCCTCGACGACGCAACCGTCAGCAACCTCGATGACTTCAGC
GATACGGTTCAGCTTCATCAGCTCTAATACTGGGTCGTCCGACGATACCACCGTAGCCTTCTTGCACTCGAGAGTTTCGCTTGCCAGAGAGTTTGCCGCA
GCGTTAAACTCTCTCACCACATGCAGGTACTTCACCGACCGAAGCTTGGCCGTGAGGATTTGGTGGTGACTGAGTTGTTGCAGCAATGACTCCTTCCGAC
AGGCTATCACCCCTAGGGCTTCCTGGATCGCGAGCCTCGAGTCACCAACGACGAGTAGATCGTCGGCTCCATGCTGTAATGCAGCAGAGACGCCGTTGTT
CATCCCGGTGTACTCAGCGAGGTTGACAGTGGTGTTCTCGAGGTAAGCGCTCGCAGCAAGCACTACAGGCCACTCTGGCAGCTTCCATAGTATCCACGAG
CAACTGCCATATCCACCGTTCTTCTCGGTCTTCGCAGATCCGTCAAACGACATAACGAAGCCTCGGTAGGACCGCGGTAGGCGTGCGTAGAGCAGATGCG
GGTCCAAACGAGCAGTTGCTGACCCTCGTATCCGGGGTGTGACCAACGCCAGTGACTTATCCAAATCAACGAAGTTCGTCAAGCCGGCTTGAAGTAGCTG
GGCAAACGAACAGTCCGTTTCTTTGACTCATTCGACCAACAGGTGCCACGGCGATAGCAAGACGGCGAACTGGGTAGCCCGACCGAACAATGTCTTGGAC
TTGTGGACCCAGTCGAGTGTCGAAAACCGAGTGTAGACCCGGATTCGCTGTCCAACGAGTTGAGTAAAACACACCTTCAGTATCAGCAGAAGCGCGAGGA
CCTCTTTCTCGGCCGGATGATAATTCATCTCAGCATCCTTCAAAACACGTCCGCAGAAGCGAACGGGGTGTAGTTTGCCCTCGTGCTCATGCATCAACGT
GGAACTTAGAGACCAATCGTTGGTGAACAACATAACATGGACTTCCTTCTTCCGGTCGAAGTATCGTAGTATCGGCGCTGCCGAAACCTTCTGTTGGAGC
ATCGCGAAGCTGTGCTTGGCCGCGGTGAGGTCACCCCCCGGGCGGAAGTCCTCGTCCTTAAGCTGGTACAGCGCTGCTCCATAGACCGCAAAGTCTTGGA
TAAAGCGACTGTAATAGTTGAGTGCCCCAAGGAAGGACTGCATTCATTTCTTCGTTGACGGGAACGGAAGCTCGGTCACCCCAGCCAGCATCTTATCGTC
CGGTCGGATACCTTCTGCTGAGACTTCGTGGGACAGGAAGTCTACCTTGGACTGCACAAAGATGCTCTTCGTGATGCTGATACTAATACGGCACTCTTCA
AACCGTGCCAGCAATCGGCCTAGCGTCGCCAAGCACGACTCGAAAGTCTCGGCACCGAAACAGATATCATCCACGAATGACCGGCGACTGAATACTGGTG
TCAACGAGGAGTCAGCGGGCTCCCCGTTGGCGAACATGTTGGCGATAGGGCTGTTGACCAGTTCGGCTACAGCTCCCTTACCAAGCGAGTTGTCTCGGTC
GGCCTCGAACTTGGTCCGGAATGGCTTTGCCGTACCAGTCGAAGCCTCGTTCACCCCAGCATGAGCTTCCTTGTCATGTTCTTCAGCTAGACGCATGCGC
TCCGAGAATTTAAACCATTCTCCCGTCGGTTGGACGAAGCCCCAAAGCGCGTTGTCAATCATGCGTTGATAGATCATCGGTGCGTTCTTCAGGCCGAAAG
GCATACGCAACCATTCGAAGTGCCCCAGTGCGCAGACGAAAGCAGAGATCTTCCGAGCTCGTTCGGTCATCATAATGGCCCAGAAGCCGCTAGCGGCGTC
AAGCGAGCAAAACCACAAGTACGCCTCCATGTCCGTCAGCAAGTCATCCACCAAGGGCATGGCGTACTCCATAATCTCGGTGATCGCATTAACGAGTTTG
TAGTCGATACACAGGCGGATATCCACCCCATTCTTCTCCAGGACGATGACGATTGGCGACGCCCATGGGCTGTCTGAGAAGGAGATAAGCCCGGCCTTCA
ACAGACCCTTCACCAATTCGTACAGCTTACCGAGGAAGCGAAGCGGGGTCCGCCGAGCCTTCTGCTTGATTGGCGCGTGCCCCTGTATATTGATGTCACA
CACGACACCGTAGGCTGGAGGCGGCAGGGCGTTGCCGCTCGCAATCA