Description :
From Genome Similarity Track
Location :
Scaffold_79:33304- 41409
Transcript NameFunction/comments
Physo_139824reverse transcriptase
Physo_139825hypothetical protein

Sequence
8105 bases(100 bases per row)
TACCAACCTATAAATACATTCAGTCTTAGATCTACTGCTTTTCAAGTCAAGTCGTCCCCTTCAGACCAGGGACACGTGAACGGCTGTTCACTTGGAGTTT
GTATACTCCTGCTTCCTCTGTTAAGAAGTGCTGTGTGCCCCGTCACACTTGGTAGCACTTGTAGTCAATCCTACGCCTACGCGGGTAGATTGGACTACCT
GAATCCTCTGTGTCTCATCGAGTGAGCCAAGATGGATCGGACGGAGTTCCCCATCCGAACGACTCGCAGTACGAGTCCGTTCGTAAGATGGCAGGCATCT
TTGGGACAGATGCCCTGCGAAGCTTAGCGGCGGCGACGCCGGCTGAGCAGGTTGAGCGTATCAACGCGTTCGACACCTACGAGCGAGGGCTCATCGCCCA
CGTTCAAGGGCTGCAGGCCACTGCGGCCGCGCCGTAGCCGGTGCAACCGAAGCCCCTGCGGCTGAAGGTTCACCCCTTCGAAGGGAAGGAAGGAGAAAAC
CTTCACTTCTGGGTTCGAGAGGTTGAGCTCGCGATGGACGCGGCTCTCGTCTCGGTCGAGCGACTCCGTGTCGCCTTTGCGCTCTCCAACCTTAGTGGTC
GCGCTAAGAGTTGGGCGTATACGCGCGAAGCGACGACGCCTGGATGCTTCGCATCATGGTCCCAGCTGTGCGAGTAGCTGCGGGCCGCGTTTTTCCGGCG
AACTACGAGTACCGCCAGCGTTCGCGCTTCCTCGCCTGCAAACAAGGAAGGCGCGAGCTGCATGAGTACATCCAGGAGATGTGAGTGCTCACTGCCTCTT
TGGTGGGGAACTCTCTGCCTGAGCACATCAAGGTGACCGTGTTCATGGACGGTCTGCGTGTCGGTCCTGCCCGCACGCAACTGTTCCGTGTGCAAGCAAA
CACTATGGAGGAGGCGATTCAGATCGCCCTCCAGGAGGAGTACAGCCACAAGCAGGCTCGTACCCCCGCCACGGTATGGCAGAGCAACCCTGCCTCTGGC
GGTGCGCCTAATGGTAACTCCGGCAATGGAGCGATCAACGGGCCGGTTCCCATGGATCTGGGCATGGCCGAGCAGAGAGACATTCGCTGCTACGGCTGTG
GCAAGCTTGGGCACATGAAACGTGCCTGTCCCGCGGGAGGACCGAAGAAGAAGTTCTCTTCGAAGCCCTTTGGCTCTAGGGGTCGCTGGCAGAAGCCGCG
CCCCAGGAACCAGGGGAACGCTGGACACCAGTAGGGGCGGGGCACCCTACTGGGGAAACACTAAGTCTTCATGAGGGGCGTGCGGGTGGCGCACGCCATG
GGGACTTAGCCCCTGAGAGTCTCTGTACTCTCGAAGCGGAGAAGGGCAGCGGTGGGCTGCTTGTGGTGCACGCGAGTGTACCGGGATACGATCATCCCTT
GAGAATCTTGATCGACTCTGGGGCGTCCAAGAACTTTGCGCGCCGCCAGACTGTCGCACGCAATCGCGACAAGTACGCCGATGCGCTACGAGACAGCAAA
GGCAACGAGCTGGTCTCGGTAAGACTGGCCGACGGTACGGTGGTAGAAGTACCTCGGGTCCACATGGACCTCACTGTCAAGTTCGAGGACTTCGACAGCA
CGGAGCCGTTCTTGATCCTAGACATGGACGAGTACGACTTGATCCTTGGCATGCCGTGGCTGGAGAAACACGAGCCTTGGATCGACTGGCCCGGCAAGGC
CATCGGGGCCAGCCGTCCCCCACGCTCTGACAGAGCTTTGGTGAGTCATGTTCCCACCTATGGCAGCAGCTGGGGCGCCCGCGAGGGCCGCCAGGGCGCA
GCAGCGTCTAATGAGTTCTTGGAGTCCGTCGAGACTGACGACAACTCCGACCAGGCCGGACAAGGCCTGAGAGTGGAGGTGCCGGACAGCACCTATCAGG
TGGGTAACGTAGGTCCACACGCGGGTAACTAAGTACCGCAGGCAGCAAGGGCTGCTGGAGAAGGCACCGCTGGCGTTGGCGTAGGTAACCAAGTTCCACG
CGAGGTCACTCAGACCGTAACAGATGAGGAAGGCACTGTAGGCGCTTCCGATGTGGGTAACATAGTTCCACAGGTGGTCACTCATCCCATAACTGATGCG
GGAGTCGCTGGAAGCGCTCCTGGTGTGGGTAACCAAGTTCCACACGGCGAGGTGGGTAACATAGTTCCAACCAGCAAGGCGGGTAACCAAGTTCCGCTCA
AGAATATGGGGGGTAACATAGTTCTGCTCAAGAACAAGGCGTCCGCGCAAGATCGAGAAGATCGGTGGTGCTGCCAAGGCGGCGCCACGAGACGAAGACA
CCCGAGGGTCACGTCGTAAGCCGGGCCTAGTCGCATGGTCGACGACGCCAGCCGCCGGCGACTCCGAGCCTCCAGCCAAGGCTCCAGCCGCCGAAGAATG
TTATCACATCTTTGGTGGCGTGACCGGTCGTCGGGTCAAGGCAGGAGCTGTCGAGCTTACAGCTCTGCCCGAGGTTTCAGAGTTACTGAACCTTGAGGAG
CTCGCCATGGAGGACTTCTTGGCCGAGCTAAAGGCCGGGGAGATCGCAGAGTTGGTTCTCCTCCGACCGCAGTCCACGTCGGCCGGGTTGAACTCGTCCT
CGGTCATGGACCAGGCAGTCCTGGAGGAGTTCCAGAGACAGCGCGCGTCGCGCATGGGCTCTGAGATTCTTAAGAACCCCCGGGACCCGGTGTACCCCTT
GGTGAAGGAGTTTGAGGACGTGGTGTCCAAGGATCCACCGTCCAATCTCCCTCCGGACAGGGGAATCAGGCACGAGATCGATCTCGTGCCGGGCACGAAG
TACTGTGTCACGAGGCAATGGCCTCTTCCCCGGGAGCAGTGTGAAGTCATTGATGCCTTCTTTGCCGCCAAGGCGAAGGCAGGCATGGTGCGGGAGTCGA
AGTCCCCGCACTCGTCGCCTACCTTCTGTGTTCGCAAACCGAACGGTTCATGCTTATAACAAGCTGAACAGCGCGACAGTGCCTGCGCAGACACGATCCC
GCGCAAGGACGTGTTGCTCAACAACATGGCCGGCTGCACGCTGTATAGTGCGCTGGACCTGGTGGATGGATACTACCAGATCATGATGCGCGAGAGCGAC
ATCCCACTCACGGCTGTGAGCACGCCGAGCGGTATGCTCTGGGAGTGGCTGGTCATGCCTCAGGGGCTTTCTAACGCCCAGGCAACGTTCAAAAGCTTGG
TCACACAACTGTTCCGACCTTTGCGTAGACGTACTTTGACGACATCTTCGTCCACAGCCGTACCGAGGCAGGCCAGACGGCCATGGAGGTGCATCTCCAG
CACCTTCGACGTGTGTTCGAAGTCATGAGGGCGAACAAGCTGTACGCCAACATCGACAAGTGTGTGTTCGCAGATCAAGGTCCTGGGCTGCTTCGTCAGC
AGCGCCGGGGTCCGGGTGGACCCGGAGAAGGTGAAAACCATCGCGGCCTGGCCGCCACCTCGGTCGCAGAAGGACCTATGACAGCGGTTGGGCCTCGCCA
ACTACCTGCACAAGTATAGTGCAGGCTACGCCGAGCTGGCACGGCCCTTGTCGGATCTCCTGAAGAAGGATGTCGACTGGCGCTGGGAGCGTCGCCATCA
AGATGCTTTTAACGACATCAAAGCGAGCTTACAGCGCGCGCCAGCCCTGGCATTACCGGACGAGACGAAGCCTTTCAGCGTAGTCTGTGATGCGTCTGAC
TACGCAATTGGCTGTGCGCTATTGCAGGCCGACGATGAAGGCCGCGAACGGGTCACCTCGTTCCAGTCCAGGCAGCTCAAGGCAGCCGAACGGAACTATC
CAGTCCACGACAAGGAGCTACTTACCATGAAGTACGCTCTTGTCAAGTTCCGAGGGCACCCCCTGGGCTTGACGCCCTTTGTCGTTTATACAGACCACGC
GTCCTTGCGGACTGCCGTCAACACGCCGCATCTCTCACAGCGGATGGCGCGTTGGCTGTCATTCTTCGCGGAATACAACTTCCGTGTCGAGTACAAGCCG
GGCAAGTTGAACGTGCTTGCCGACGCGCTGTCGCGCCGACCCGACCACGAGCTTGCTCATATTAGTCGGGTCACGACGGATCTGTATGATCGCATCAGGC
TGGGGTACCGAGACGATGCCAGTCTCGGACCTCTTGTGCGGTTCTTGGCCGCTGGCTCGGAAGCCAAGGCCGAGTGGCTCACGCCCCGACAACGTGCAAG
GCTGCAACGCTATGAGTGGGCTGACGGTTTGCTCCACTATAGGGTCGAGCCCGAGGATCCTCCCCGTATTGTCGTGCCCAACGACGAGGATCTCAAGTAG
GACATCCTGATGGAGGTGCACGACGCTCCATCCAGTGGCCATCTCGGCCGTGAGAAGACGTACGCGTCTGTCTCGCAGATGTTTTGGTGGCGTCACATGT
ACAAGTGGGTCGCCACCTACGTCCGTACGTGCGAGACGTGCCAGCACGTGAAGCCTGCCGGTCAAGCCTCGGCACCATTGCAGAGCCTGCCGGTCCCAGC
GGACTGCTGGAAGTCGATGAGTCTCGACTTTGTCTTCGGACTTCCGGCCGATGACCGTGGCAACACTGGTGTTGTTGCCTTCGTGTGCCGTCTGAGCAAG
ATGGTCCACTTTGCTCCAGTTCGTGACACCGGCACTCGCTCGCCTGTTCATGGACTGTGTCTTCCGACACCACGGTCTGCCCGAGACCATTGTCTCTGAT
CGAGACCCGCGGTTCACCGCTACGTTCTGGCAGACGCTGTTTCGCCTTCCCGGCACACGACTGTCGAAGTCGACGGCGAACCACCCGCAGACGGATGGCC
AGACGGAGCGCGTCAATCGCGTGCTCGAGGACACGCTCCGCAGTATCTGCGCGGAGATGCCCCGCTCTTGGGCTGATCGCTTGCCCATGGTTGAGTTCGG
ACTCAACAATGCGGTACATGCATCGACGGGCTTTACGCCCTCTTACCTGAACGGGTTGTGCCACCCTCAGGTGCCGCTCACATTACGAGGCAGTACCGGG
GCTTCGGTCCTATGTGGGGGAGAGGCTCGGAAAACCTTTTCCTCCCAAGTCTCGGACGTGAGTCCAGCCGCCTTGCGGAAGCAACTGTCCTCGTTTGCCG
AAGACAGGCCCCGGTACTGCCTCGTAATGTGAGCGGCACCTGAGGGTGGCACAACCCGTTCAGGTAAGAGGGCGTAAAGCCCGTCGATGCATGTACCGCA
TTGTTGAGTGCGAACTCAACCAGCGGTAGGTGACCCTCTGGCTCTGGCTGCCCCGCCGGAAACGGTGGGTGGCCCGGTGGAGAAGCTCGGTCGAGAGCAA
CAAGCTGAAGCACCGCTTCATTGGACCCTTCACGGTCCTCAGCTGGCATGGCGTGGCGTACACCATAGACTTGCCCAAGTCGATGACGACTCACCCGACG
TTTTACGTGGGTCGTCTTAAGAGGTACCATGACCCTCTGGCTCTGGCTGCCCCGCCGGAAACGGTGGGTGGCCCGGTGGAGAAGAGCGCAGCTCCTCGAA
GCGCGGCGTCGGGTCGCGGTAAGGCGCCTGATACGCGCGCTGGTCGTAAGACGGCGCGGCGTACATCGGAGCAGCATACGCAGGGGTCCCGTACGAGCCC
TGGCCAAACTGGGCCTGAGACGAGTGGGGCTGCCGCTGCTCCGGATACGGCGCGTGGCATGAAGCTCGGCCCGAAGGCCAGTGAGCTGGTTTCGCAGCGA
GTCGTAAGACGACAGGTCGGCTCGACGATCCACGCGGCCATGGAGACTGCGAGTTTCTTGATAGAGCGAGGCAACTTCCTCACGGAGCCGCTCCACGGCT
CCAGGCTGACCAGCACGAGCGGCAGCCTCGCCACCAAGGCCGACGCCAAGCGCGATCTCGAGGACGTACACACGGTCCCGGAGAAGACGAATCTCCTCTT
GCTGCAGGGCCACCAGGCCCCAGCATACGGCTGCGTCGCCTCAGGCTCGTAGCCATGGCCGTGCGAGGCCACCGTCGGCCCTCCTTGACCGTAATGGGCA
GATCCACTACCACGTGGAACGAGTCGTCCGGGAGCGGCGGCTCCATGGCAAGCGCCAGCTGCTCGTGAAGTGGAGGGGTTACCCTGAGTCGGATAACTCG
TGGGAGCCCGTTGAGCAGCTCCAGGCAGACTGCCCGAAGGCTGTTGCGATATGGGACGAGAAGCAACGGCAGCTTCGTAAGTAGTCCTTGGCTTCTTGGC
CGATACCCGGGGCACGGTAGCAGCCGTAGTCGCACCGCGCCCACGCTCTTAACGAGCTTTGGCTCTCGCCTCTTGCTTGAGCTCGTCCATCTTCGGACGG
AGCTTGCGCTTGCTCACGAGTTGAGCGAACTCGATGCGGAACTCGCGCACGTCCAGGATTGCGGACAGAGTGTGATCCTCATGGAGTTCTTTGAACTCGT
GGTCGGAATACCCTTTGCGCTGGACGTAGCGCCAGAAGAGGTCTTCCACATCGTTCGAGGTCATGTTCTCATTCGGCTTGACTCAGTGGTAACCCCACAC
AGGATGGAGTCCACCCTTGTCCTCCGGCTTCTTGCGAAGCGTGGCGAACTCCTTCAGTGTGAGCTTGTGTGGTGCTAGTAGCACACACCGGGCGACTTCA
ACGTCGCCAAGAAAGAGTGGTTCTTTCTCAACGAGAGCACGCTCATAGGAACCCCTCGAGGTGTACCCGCCGATAAGGCCACGAGGAGCCGAGAGCTTCT
CCAACAGCGCTGGCGCACCGGTGCCAGGCTCGGGCGGGAAGTAGCCCTGCGGGTACGTGGAATCCCCGCCTGTAGAAGACTCGATGGCAGTCGTGGCAGT
CGGCTGCCTGGCATACGCGCCCGAGCTAGCAGCGTGGTATTGCTGCTGCTGCTCGTCGAGGTTGTTGGAGAGCTCCGTGGGCTCGTGGACGGCACCCTCC
TCGTCCTCAGACCCCGAATCGTCGAACAGCCAGGAGCTGGAGCCGCAAGGCGACCTGGAAGCTGAGCGCTTCTTCGCCTTGGCCTCGGCGGCCTTCGCAG
CGGCAGCCGTTTTTGACGCTTGGGCACGATCACGACCTTGCGCCAGTGTCAGATGCTTGAATGCCAGCACCTCCTTGGACTTGGAGCCCGCGTCGCCCGG
CGACTTCTCGGCCACGACCCCAGCGTCGGTCATGGCGACTTCGTCGTGCGACTGCGTGCTGTCGCCTGCGCCGGACTCGGCGTCCTCCGCCTCCTTCTCC
GACGAGGCCTTTGCGTCGGCCGAGGCGTTGGCCATGTCGCCTGCCGCCAGCTCCGTGCCTTCGGCGGCGTGCGTGCTGCCCTCCGAGACGTTCTCGTCGT
CGGGTGAACTCTCACCGGAGTACTGGACCATCGTGCAGTCAAAGACGGCGGCTTCCCAGTCGCGAGCCGGGCTTTTATGGCCCCGAGGACTCTCCTCCTT
GCCTTGCGCGGCGTCAGGAGACTTGCTCCGAGCCCCGGCCTGACGGCCACTCTCCGGCGTTCTGCTACGAGAGCGCACCGCCTCCTCGGCCGCCTTCGTG
GCCTCCATCAGCGCGAACGACTCGTCCTTGGCCTTGGCCGCCCTGGTCTTCGCCCCTACGGCCCGCGGTTTCGGAGGTGCTTTCGCACTGCGCGCACTGC
GCTCTGGAGGCATGCTTCCGGTCGACGTGGAGACCCTGCGGCTTGCTCGGCGATGCGCCAGTTGCTCTGTGAGGCCCGGGAGCCGAGGCGCCAGAGCTCG
CGCCGTTGTCGATGGATTTCGACTTTGCGAGTGAAATGTGTGTCGCCAGCGTAGCCTCGCTCTGATTGGTCGATAAGATCGAATCTAAGTGGGGGAGGAT
GTAACGGGGTTACATGGAATAGTGACCCTATCACTATTCAGGGATGGCTACATCGGTCACTCCCCTGGATAGTGACCCAAGTGGCCTCAGAGCCAACAGA
TACATTTTGTATGACACAAACTATAGGGAACTTAGGATTTGTATGCAGGCCAAATCTATACCAACCTATACATACATTCAGTCTTAGATCTACCGCTTTT
CAAGTCAAGTCGTCCCCTTCAGACCAGGGACACGTGAACGGCTGTTCACTTGGAGTTTGTATACTCCTGCTTCCTCTGTTAAGAAGTGCTGTGTGCCCCG
TCACA