Description :
From Genome Similarity Track
Location :
Scaffold_752:333- 4061
Sequence
3728 bases(100 bases per row)
ATCGCATTCACGTTGGTAAAAAGCTAAGATAGCTACGACACCAATTTTGAGACATTTTGGTCCGGATCGATCTCCGTTGATTGTGGTATTTGCCAGTGAG
CGGGCAGCATCGGCTGCGTTACTCAAGGAGTATAAGGGCTTGTATTTACCTGTCACATTTTCTAGTCGCAAGTTGAAGCCTAACGAAATTAACTACAGGA
TGGTCTATAAAGAAGTACTTGCCTTTCTCCTAATGCTGGATATATTTGCTATGATATACTGGTATCACGCAAAATTACGGTTCTCACGCGATACTCCACA
CTATCCTGGTTGCTACAATCTCCTGCCCTCTACGGAAGATTAGGAAAACGGGTTGCATTTTTACCCTAACTGGACACTGGAGTTTCGTCGATCTGAGAAA
GACAAAGATGAGATATTGGGTGCGCTGGCTGCTAGTGTGACACCCCGCGAAAAAGTGGACGAAGTGTTAATTGCGATTGCCCCACGTAAACAGCCAATCC
AGACAATAATTACTCTCCTCCTATAGTCAGAGCAAACGAAAACCTCCTAGTGGCCAGCTTCGATGGATCGGATAGTGTAAAAAAGAAAGGGAGGCATATA
TCGCGATAATATGGAAAATGCCTGAATGGACGATCGTAGTGGCGGCCTCCGAATTTGCCCCCGACCTGACTGTAAATAAGGAGGAAAACCGAGGCTTACT
TCTCAGTTTTAATTTGCTCGCGGGCCAGCTAAAGGACGGGTAATTATGTGGAGATTCAAATTTGGTGATCCGTCAAACGCGGGGAGAGATTGACTACAAG
GTTCCTGGACTGCAAATGCTTCGTCGTAAATCTATAGAGATACTCAGGTCGTCGTTTATCCACTAATTTTTACATATTAAACGAGATTGAAATCAAAGTG
CATACCGATTGGAAAATGAATCCTTACAACGAGAGGAGGAAATGGTTGTGGTCTCAGAACAAGATCGTCAGGATCTGATCACTTTTAATAGTCTAAGTGA
ACTACTATTACCAAAACGACTGAGTACCCAAGTCAGGGAGGTTACTATCAATCTATCCTCCGGGAGAGGACACTGCAAACCCAGGATTCTACAAGAAAGG
GCCGTGTAGAACATTCAGCTTGACCGTATCAAACAAGGGCAAGATGAGGAGAGTTGGATAGCTGATCTGAAGGCATATTTGGCCGGAGATGTGGCGAGGC
TATCGGCGGCGGAAGCCAAGGTCTGCACCTTAATCGCGCCCGGTTATGAGATATATATTAAAGTGGGCTGTTATTATTTTGCCTAAGATCGGCCACCCAA
GTGGAAGAACTTATAGAGTCGATTCTCTTGGTGGTGCCAGAACTATTACAGCGGGACTTCTTGCAACACTATCATAAGTTTGTAGGGTGGCCACAAAGGA
ATAAGATGCATCTATCAACGGATCAGGGCGAATTTCCATNNNNNNNNNNGTACAGAAGTGTGCAGCAATATGTGGGAGAATGTTTAGACTGTGAAGCGGG
AAACGGACGACCCCAGGATCGGAGTGGGTCGCTAGGAAATTTACAAGCAACGTATCCTTTATCGATTCTAGCTATGGTTCATATTTCGTCGCTGCACGAT
CCTTTGAGCGGAACACCACTAGTTACTGTGGGTCAGCTTATTTTCTAATTACGCAATCTCGAAGGCTAGCTCGTCCAGAACCGCACAACGGTCGCGGAGA
ACTACGAAGAGTGCGTATTTAGCTGGTTCGGTGTTAGTGAAGCAATATGCCACGATCGGGAGCCAGAATTTATGTCCAATTTCTTCCGAGATTTTAATCG
GATCGCAGATCACAAACAGGGAGCTACTATGGCGTATAGGCCGCATGCCAAAGGTTCAGCGGAACGCATGGTGCAAACGTTGACCTGGGTGATCAAGATG
TATGGGGTGGATTAAAACCAAAAAGGTTGGGACGAATATGCAGATCGATTGACTAATACGATTAATACTGCGCAGGACAGAGTCTGTGGGGATATGCCAT
TTTATTTGATCCATGGTTTGAATCCAACATCAACCTTGGAGCAACCTTACATTGGGAAGCACCAACCCTCGTGATCGAGACCCACGATGTTGGCGATGCA
ACATCCAACATCAATTTCAGCGTGTATGGGCGGTAGTGAACGATCGACTCGAGAGCGCGATCCAAGATCGAGCGCATCGACAAAATGAGGATCTCGACTC
ATTGGATGTAGGTTTTGGATTGCAGGTTTGGTTGTATCTGGGTCGCGTTAAGAAAAGGTACGCTCGAAAGTTAGCTCATATGTGGCATGGACCGTATCGG
GTAGCCGAAAAATGTGGAGATCACACGGTATGCTTAGAGATCGCAAACACACCTTACAGATTATTCCCCGTATTTTACGTTTCAAAGCTGAAACTGGTAA
GGGTCTTCCCAGAACGTCCTACCACCCAAACAAATTTTTAAGAGAAGGATCGATTCGAGTATGATAAAGCTTTGCTACCGGAGAATAGTTGGAAATGCGA
TCGAGACAACAATGGAATGAGGTGGATAAGATTGTTGATGTGCGATCGGGGCGGAAGACCCGATATGGGAGATTTCACAGGCAGTATCTGATACAATGGA
AAATGTATGGTGACTTCTCCAGGATTGCCGGAGCTGATCTGAACTTTAAGACCTAGTTCCAGAAGCTCGATCGAGATTTTCTGAGTAGGAGCCGTTTCGA
AGTAATGCAATCTCATGAGGAAGAGTCCGAATATTAACGGAGTCGAAAANNNNGATACTTGAGATGGTAGAAGGGTGTGTGTGATATGTTAGATGGGGGA
AGGGTATGTTATGTGCAAGGAGGTTTCATTAGATGGTGGAAGGGTGTATATATGTATGCATGTGGAGGTTAGCGAGCGCATATATCGGATAGCGGCAAAG
CACGCCAAAAGAAAGAAGTTATTTTTAACGGAATGGAGATGACAAGAAATCAGGACGGTCATCTCCATTCCGTTAAAAATAACTTCTTTCTAATCCGATC
TAAATAATACGCAGGGAAGAACTTACCGGATAGGCGTGAGACCGACGATACAGGATGACTTGCAGGAGAAAATCGATACTGGTTGCGCCAAGGCTCGTCG
GCGTTAACATCGACAGCGCTGTAGCCAGATTTGTTACATTCTTACGCTTAAACCCAAAGCCAGAAAACCAAGACAGCACCACGTATAATCCAGTGAAATG
AAGGAAGAAAGGATCCAAAAGGGTGTTTAAGTCGAAGTGGCCGTCTATCAGTTTTTGAAGGATGAATCGAAGGATCTTTTTCCAACAAAGTCCAGATCGC
CTACGTCTCTGCTTATGTTGACGACAGAATTGGGCCGGATCGGGATCGAGCTCAAGCTGTTCTTTGGACAAGTAGACGGAGTGCGTCGACGCTCACACAG
ACTGCGGGGACCGCTCTTCTCAGTCCATGTACATAACAGCGAGTAGACTGAAAACCCAATACGGGGAAGAGATATCGGGGCGATCTTCCGAAAAGCACTC
TTTCAAGGTTCTTGCGCATAAATTGCCGCGATCTGATATGAGGTTGTCAACCGAGGGGTCACCGGAGGCGGAGCGATCTTCGGGGCTTCGAGAAATGTCG
TGCGAAGCAATCAAGGTCGAGCTCCGCCACGCTTGTCAAGCCAACGCATCGCGAAGACCATGGGGCGACTTGATCGAAAGATTGGGATACCCGATACAGA
TATCCAGGGATCCAGATATCCCGAGCAA