Description :
From Genome Similarity Track
Location :
Scaffold_565:333- 1556
Transcript NameFunction/comments
Pytap_DAOMBR444maker-pag1_scaffold_565-snap-gene-0.10WD domain-containing protein

Sequence
1223 bases(100 bases per row)
AGACTGCTGAATCTCATGGACTTaCcGAGCTTCTAACCGCCGAAGATTTCACGATCGCGTCTCAATTCTCACAGACCACtCACGAAACTACAGCAATGGC
GTTAATATTACAGTCGGAAGTTGATGATCGCGACATCTCCACTGGACGCGCAAGCTGAGATCAGATTGCCATCCTTGTTCCAATTCACTTCGTAAATATC
CCCATTTGCTTGATACGTCTTGATCAGAGAGAAATCCTTGAGTGACCAGACGTTGACGATGCCTCCTATTGTTCCACTAGCCAAGAATTCGCCATTTGGG
CTGTAAGCGACACCGTAGACCGGATTCCTACAGAAAATAACGCCGGTAAGACACGATGAAGTGATAGCAGCTTAAAATGCAGTGACGTGACGTACGAGTG
CTCGAATGTCCGACTACAGACGCCAGTCTCAACGTCCCAAAGCTTCACAGTTGTATCGAATGAAGCGCTCGCAAGGCTCAACGGCCCGTTCGGTGAAGCA
GAACCTGGGCCAGAGCAACTCCAACGGAAAGTATAGACTTCCTTTTTGTGCTCTTGAAGACTGTGTAGGAACATGTTCTTCGGGGACTTGGTTTCGCTCT
CATCAGCGGCCGGGTTCGACCCATCTTCACCTTCAacGCcGTCATCTTGAGACGATACTCTAGATGGATCCCACACCTTCACGGTATAGTCATCAGAACA
GGACGCTAGTAGGCGACCTGATGGATCCCATTTCACAGAATTgaTCGCATCCGTGTGCCCGCGTAAAACCAAGCTcGgTTCCgTCGCGTCCACTGATGTG
ATACAAATGCGTTTATCCGCAGAACATGTTGCGAAAGTTGAGTCATCTTTCCATGAAGCGTCAAGAATCGGCTCTGTACCATTTTCAAAACCgCATTAAT
ACTACTCGCTCCAAGCTCCAAgTAGACAAtccAGGAGTTCTGCAGACGTACCATCATGCAGTTTGACTTGATGGTGTTTATCTTGCGTAGtGGAGTCCCA
GATTGAAACAGTCTTGTCGAAACTCGCGCTCAGCAGATATTTACTCGATTTGCTCCATCTCGTTGCAAAAaCTGGgCcATTGTGGTATTGAAATACGTGT
TTCAGCTCACCATCCGcATTCCACACACGAgTTTTTCCATTGTACGTTCCGGAGGCTAACATGGACCCGTCATGCTGAGATACACGAATCGAGaTGTGAG
CTTACAAATGACCTCAGAGTTGA