Description :
From Genome Similarity Track
Location :
Scaffold_1635:333- 1453
Transcript NameFunction/comments
Pytve_DAOMBR484maker-pve_contig_1635-fgenesh-gene-0.0Pectin lyase

Sequence
1120 bases(100 bases per row)
GAGGTTGCCGACACCGAAGTTGGTGTTGCTGAGCGAGAGCTTGGACGCCGTCGTCGGCTTGTACGACTTGGCCGTGTAGGCTCCCTGCTTAAGCGCCGTG
CCGCCGTTGAGGTTGGTCAGTCCGTTCTGGGTGTTGACGTTGACGTTGTTGACGCACGAGCGACCGAGGTAGGACGAGCAGGTCGAGCCGCCCGACGTCT
CGGCGTAGAGTGCGCTGGAGGACTCCGAGATGAGCACGGGTTGCGTGCACGTGTCCATGTAGTTGCCCTCGACGACCGTGAAGGACTCGCCGGTCGGGTT
GAAGTTGTGGCCCGAGTTGTTGTAGAAGTGGTTGTTGGCCGCGTGGACGATCGAGTTGCCGCCGATCTTGGGCGAGCGACCCGACGTCTGGTGGATGTAG
TTGTTGATCAGGCTCACCTGCGTCTTCGTGCCGTAGAAGAGCATCGTCCAGTAGTGGCGGTTGTCGCACGTGGCCGAGTACTCGGTGTAGCCATCGAAGT
CGCAGTTACTGATCGTCATGCTGTCCGAGGACGCCGTGTTGGTGACGATCATCTGACGACCGACCTTGGAGAACTTGACGTGGTCGACCCAAATGTTCTT
CATAGGTTGGCCGTTGTTCAGACCCTGCAGGTAGAGCGCGTCACCGCCCCAAATGACGTGCGGGTTGAGGTTGGTGATGTGGATGTTCTGCACGATCACG
TTGTTGCCGATAATCCAGAGACCCTTGCCGATGATGACTCCCTTCGTGCCGACACCGCGGATCGTCTTGTTGCCAGTGATCTGCAGCATGCTGCTCTGCA
GCGCCGCTTTGTCATAGGTGATGGTCACAGCCTTGCCGTTCTCACAGCCACCCGTGCCCGAAAACCCTCCGGACTGGAGGATACAGTCCTGACCCTTGTG
GCCGTTGTTCAGTGCGAGACACTTCTGATTGGACGGCGGACGGCAACCAGTCTCAGTCTTGGTTCCCTCCGTGCCACGGAAGTCGAACGTCTTGTTGAGG
ATGATGACCTGAGCGCTGGTGCTCTGCAAGTAGCTCTTGAGTTCCGCAATGGACGTCGGGTACACGGGTGTGGCGTTGCCGCCGCCCGTCGTCTTGTATC
CGAGACCCTTGGCGGTGCCG