Description :
From Genome Similarity Track
Location :
contig_38:332968- 335383
Transcript NameFunction/comments
g7124.t1hypothetical protein PHYSODRAFT_353490
g7125.t1RNA polymerase-associated protein CTR9

Sequence
2415 bases(100 bases per row)
GGTCAACTCGCGATCAGTGCTCTAGGTGGTTGCATTTGGCACCTACGACGCAGTATCATCGACCAAGAATTGCTTTCTCTCTGCAACTTCAGAAGATACA
AGCCTTCTGATGAGGAGACACGAGATGCTCGAGTAAACAAATCGTTATCCGCTGCGACGGCCGAACTGAACCAGCAGTATGTTGTTCTGGATTCGCAGAC
CATCCAGAACCTGGAAGTGCTTACCAACACTTTAACGGCACGCGGTCAGGATCTCTCATCGATATCATGGACAAGACTGTAACGAGTTTTGGCCGTCGAA
TGTTCCAGGAGTGGGTTTTAAAGCCGCTGTGTAAGATTGGGGATATTCAAGAGCGCCTCGATGCCGTTGAAGAGCTCGGCAATAGTGGTGACTTGATGAT
GGAGATTCGCGAGTTTCTCCGCAAATTGCCGGACTTGGAACGACTACTATCTAGAATTCACGCGCTTGGATCTTCGCATCGCTCAAAGGAACACCCGGAT
AGCAGGGCAATCATGTACGAGTCTCAGACGTACAACATCCGAAAGATTCGAGACTTCCTTGCCGTACTAGATGGATTTGATGCGGCGATGAACCTAACGC
TTGAATTGGGGCCTCGCCTCTCTCAATCCACTTCGCCAATTCTTCAGTCACTGCTGAAGAGATACCAAGTCGAGGACGGTGTGAAGCCGGATATTGAGCA
CGGACATTTCCCCGACCTGACGGAGAAACTTGAGTTCTTCAAGCGCAGCTTCGATCAAGCTGCTGCACAGAAAAGCGGTGTAATCGTACCCCAGGATGGT
GTGGACTCAGAATTTGACGATGCTTGTGCTGAAATCGCCCAGGTTGAAGCCGAACTAAACGAGTATTTACAAGAGCAGCAAAACGCGCTGCGATGCCGTC
AAATTTCCTACTGGATCCCGAAGAAGAAGGAGGATCGCTATCAGTTGGAAGTTCCTGAGAGCGTGTTATCGAAACAGCCGAAAGAGTTTGAACTCAAGTC
GCGCAGGAAGGGTTATAAACGTTTTCACACGCCCACAATTCGCAGCCTGCTAAAACGGTTGGCCACTGCCGAGGACCACAAGGATGAAGCACTCAAAGAC
CAAACGCGCCGCATTTTCCACAAGTTTGATGAAGACTACAAGTACTGGATGAAGGCGGTGCAGTGCTTGGCCGTGATTGACTGTTTGGTCAGTCTCGCGC
TCCTCAGCAGCCAGAGTGAAGGCTACACGAAACCCGAAGTGGTGGCGGCTATCACCGCGAACGGAGGAACCCCTTTCGTTGATATTGAAGAGGGTGTACA
CCCATGCGTTGCCGCAACTTACGGCAGCGGGGATTTCATCCCGAATGACGCACGCCTCGGAATCGAAGGAAAGGGTCAAATGGTTCTCCTCAGTGGACCG
AACATGGGTGGTAAGTCGACGCTGCTGCGCCAGACGTGCGTTCTCACCCTCATGGCCCAGATCGGCAGCTTTGTCCCGCAGCGAAATGCCGTCTCAGCCC
TGTTGACCGAATTTTCACCCGTATCGGCGCTTCAGATCGTATCCTTGCTGGCCAGAGTACTCTTTACGTTGAGCTGGCTGAGACGGCGACGATTCTGAAT
CACGCTACCAGCCACTCGCTTGTGATTTTGGACGAGTTGGGACGTGGCACGTCCACGTTCGATGGCACTGCCATCGCGTACTCGGTGGTTGAGCACCTGC
TGAGCGATATCCGTTGCCGAGCGATGTTTGCTACTCACTACCATTCGCTGGTCGAAGAGTATGCGGGCAACGATAAGGTTTCTCTGGGCCACATGGGGTG
CATCGTGGACCAAGAGAACGATCGCAAGGTCACGTTCCTGTACAAGCTGGAGGACGGCATGTGCCCCAAGAGCTACGGTATCAACGTCGCCATGCTGGCC
AAGCTCCCGGACGAAGTGATCGAGTGCGCCGCCAAGAAATCGGAGCAGTTCGAGCGCTCCTTGCAGGCGAACTCGCACACCGAACTGGAAACCGTCCGAC
TCGCACAAAAGGTGAAGGAAGCGCTTGCAGAAGGCGAAGCGGGCGTAGGCAAACTCAAACAGCTATGGGAAGAAGCACGCAGCGCCATTCGCGCCTAACT
CGAACAAAAAATGTATCCATCTGACGTACGTGACCTTAATTAGGAAATCATCTGTGACAGAAATGCGTCAAGTCAAGTCGCTGGTGGAGCTGTCGGTGGT
GGCTGCGGCGCTCTCCACGCCCGTACAGGAGCTCCTGGACTATGTGGAGCTCCTGCCCATCGCCATCCGCCACCAGCTCTTCCGAGAGTTGCCCAACTTC
CGACTGCGCGAGATGGAGGTGGCGTGGGAGGCGTCTGTCCAGCTGGGGGAGGCCCCGGAACCGCGCGACGGCTTCGACCCCCAGGCGGGTGACAAGTTCC
TGTTTGACCGAGAGA