Description :
From Genome Similarity Track
Location :
Scaffold_1738:3329- 5073
Transcript NameFunction/comments
Phyta_totarag13581hypothetical protein PHYSODRAFT_345009

Sequence
1744 bases(100 bases per row)
GGCTGTTGGTGCGCGCAAcaacgctgttgctgtaTCCGCGCACATTCCAAAACTTTGGCGGCAACAGCTTAAGTCACGTGCGCTCGAAGTACTTAAAAAA
GCCCATTTCGTACTCGTGTAGATGATGTTGTCCTTCTTGCATCGCTCCTGAATAGCGTTTTTGACCCAGGCAATGCCCTGTGGTGCGATCTGGTTTCTGT
CGATCACCGTGAGCATATCCAGGAAGCCAGACAGCATCGCAACCTTCACTTGGTCTCTGTGCAGGCAATACTTCAGCATTCGACGCTTGCATGCTTGTTT
AAAATGAAACAAGCAGCCGATGATGGCTGCTTGAGGAAACCAGTCACTCACTCACGGCGTTGATAAGAGCGGTTTCGATATCGCACACGACCTCTTTGGT
CTTGAGAGCCTCGCCGCACGCGTTGGAGACGTACTGGAGCAAGTTCCAGTACGTGTCGTAGTTCCTGGACGAGcacagcacgaagaagtccGGGATGTAG
AGCTTGGGCCCTCGATCGTAGGATATTACTACGACGCACTGTGCAATCTTGTCTGGCACACAGCGAAATTTGCCATCAACAAAGAGCGTGATATTCTCAT
ACCGAAGCAAACGCAGTAGAGAGGGGTTTGCCCAGCCGATCACCCAGTCCAACTGGCCGCTCGTGTTGCCCCAGACGTGGTGGAACTGCAAGAACAGCAA
GCCGCTGTTCTTCACGTTTACCAACGGAGGTacttcaactcgaccatGCACATATGTTCTGCAGTGTAGCGCTCGTGCATGATGGACTCGCTTAATGACT
TGCCCTCGAGCCCTTCCCCGGACGACGCTGTCTTCCTCGGTCGTCGTGTAGTTCTTGGCGGTCATTTCATCCCATGTCTGGAGTGGAATCGCCGCCGTAG
ATGTCACCAAGTTGTCCAAATCAGGCGTCATTGCTGCCGTGTCGTCGTGTACCCCAGCCTCGTCGCGATCCGTAAGCGTTCGCATCGATGTCGGGATGCA
GGTGTGCGGAATGCTGTCATAGTTCATTACCGCAGCGATAAACTCGAGCTTGTCTCGGCAGCTCTGGCTACGATAAAACTACAGCGGTATGTAATCTTGA
TCTGCGTGAAGACAGCGCGCGTGTACTCGTACCCGTTCAGATACAACTTCGTCCTTCCGTCACGCATCTTGCGCGCTGGTGCATCACTACTTGGACTAGA
GGACACCGAACCGGAGCGCTGCCGCTTAGAGGACGACGGtgtggtggaggagctgtcgGCATCAGAGTCCCAAGGCGGGACGTACGTACTTGACGAAGCT
CCCACTTCCTCATCCTCAGTGTCACTGCTGCTAGCGGTGCCGTCACCCTCTGCATCACCAGGAGCATCGACACCCGCTTCATCTGCATTGCGGTAGGTGT
GCCCACGAGCGCCATGGTCTGCAgtagcagctgctgctgcagggtCATCAACGCGGTGGGGAGTGCGCCCACGGAGGACTTCAccatcaccagcaacagG
TCCGTCGGCACGGTCGTCGCGCGTCTTGCTTGCTGTAGGGCGACGGCTTCGGGGAGCAGCGCGGTCAGCCATCGTGAAGATGTCAGTTGGGTTCTTCAAA
AAGAGAAGTGGCAAACGAATGGAGCAGATGAGACCACGTTAATACCTACGCAAATACTCAAGACCTGTACGCGTGATCTCTACGAAAAACCTCGTCTGAC
CTAGGAGTGGCCTGTTCCTCGTATGATCTGTAATATATCCTTCG