Description :
From Genome Similarity Track
Location :
scaffold_38:332830- 335247
Transcript NameFunction/comments
g12744.t1 hypothetical protein PHYSODRAFT_353490

Sequence
2417 bases(100 bases per row)
CGCTACCGTGGCTACATGAACAGCGGCGCGACATCAACGGCAACACACCAGACTCCCCAGATTACGATCCGCGTACAGTGAAGGTACCACAAGAGTTTCT
GAAGAAGGAGACCCCGGCGATGGTGCAATGGTGGGAAGTCAAAGCAGAAAACATGGACACGGTGCTGTTTTTCAAGGTTGGCAAGTTCTACGAGTTGTTC
CACATGGACGCTGATGTTGGCTTCAAAGAACTCAACCTCATTTACATGAAAGGCGACAAAGCGCACTCGGGCTTCCCTGAGATTGCGTACTCGAAAATGT
CAGCCCAGCTGGTTGAAAAGGGCTACCGCGTTGCCCGAGTTGAACAAACAGAAACACCTGACATGCTCAAGATTCGAAATAGCAACCAAGCAAAAAAGTC
CAAGGTTGTTCGCCGTGAGGTGTGTTCGCTCCTGTCCATTGGAACGAACACAATCAGCTTTTTGGACGCCCCAATTTCGTCGCAGAATCGAGTCTCGAAG
TACCTCCTCGCGCTTAAGGAAGCATTTGATCCTTCCCGGAAAACCGTGCGCTTTGGCGTTTGTTTGGCAGACGCCGCTACCGGTGCCTTCCAGCTGTCTG
AGTTTGACGATACCGAACAACGGGACCGTCTTAAGACGTTGTTTGCTCAATTTCACGTTGTGGAGATTATTACCGAGCGGTTTAACATCTCTGACGATAC
GAAGATGGTGCTCAAACACGCAGCACCTGCTGCGATTCGTTCGTCACTGCGCGTCGGAAAGGAGTTCTGGGATGCATCGAAAACGATCGATGAAATCGAG
CGTGCAGGATATTTCAAGGAACATGGGTGGCCAGAAGACGTACTATATTTCTTAGAAATGGACAAGGTTGTGAAGTCCGACGGTCAACTCGCGATCAGTG
CTCTAGGTGGTTGCATTTGGCACCTACGACGCAGTATCATCGACCAAGAATTGCTTTCTCTCTGCAACTTCAGAAGATACAAGCCTTCTGATGAGGAGAC
ACGAGATGCTCGAGTAAACAAATCGTTATCCGCTGCGACGGCCGAACTGAACCAGCAGTATGTTGTTCTGGATTCGCAGACCATCCAGAACCTGGAAGTG
CTTACCAACAGCTTTAACGGCACGCGGTCAGGATCTCTCATCGATATCATGGACAAGACTGTAACGAGTTTTGGCCGTCGAATGTTCCAGGAGTGGGTTT
TAAAGCCGCTGTGTAAGATTGGGGATATTCAAGAGCGCCTCGATGCCGTTGAAGAGCTCGGCAATAGTGGTGACTTGATGATGGAGATTCGCGAGTTTCT
CCGCAAATTGCCGGACTTGGAACGACTACTATCTAGAATTCACGCGCTTGGATCTTCGCATCGCTCAAAGGAACACCCGGATAGCAGGGCAATCATGTAC
GAGTCTCAGACGTACAACATCCGAAAGATTCGAGACTTCCTTGCCGTACTAGATGGATTTGATGCGGCGATGAACCTAACGCTTGAATTGGGGCCTCGCC
TCTCTCAATCCACTTCGCCAATTCTTCAGTCACTGCTGAAGAGATACCAAGTCGAGGACGGTGTGAAGCCGGATATTGAGCACGGACATTTCCCCGACCT
GACGGAGAAACTTGAGTTCTTCAAGCGCAGCTTCGATCAAGCTGCTGCACAGAAAAGCGGTGTAATCGTACCCCAGGATGGTGTGGACTCAGAATTTGAC
GATGCTTGTGCTGAAATCGCCCAGGTTGAAGCCGAACTAAACGAGTATTTACAAGAGCAGCAAAACGCGCTGCGATGCCGTCAAATTTCCTACTGGATCC
CGAAGAAGAAGGAGGATCGCTATCAGTTGGAAGTTCCTGAGAGCGTGTTATCGAAACAGCCGAAAGAGTTTGAACTCAAGTCGCGCAGGAAGGGTTATAA
ACGTTTTCACACGCCCACAATTCGCAGCCTGCTAAAACGGTTGGCCACTGCCGAGGACCACAAGGATGAAGCACTCAAAGACCAAACGCGCCGCATTTTC
CACAAGTTTGATGAAGACTACAAGTACTGGATGAAGGCGGTACAGTGCTTGGCCGTGATTGACTGTTTGGTCAGTCTCGCGCTCCTCAGCAGCCAGAGTG
AAGGCTACACGAAACCCGAAGTGGTGGCGGCTATCACCGCGAACGGAGGAACCCCTTTCGTTGATATTGAAGAGGGTGTACACCCATGCGTTGCCGCAAC
TTACGGCAGCGGGGATTTCATCCCGAATGACGCACGCCTCGGAATCGAAGGAAAGGGTCAAATGGTTCTCCTCAGTGGACCGAACATGGGTGGTAAGTCG
ACGCTGCTGCGCCAGACGTGCGTTCTCACCCTCATGGCCCAGATCGGCAGCTTTGTCCCCGCAGCGAAATGCCGTCTCAGCCCTGTTGACCGAATTTTCA
CCCGTATCGGCGCTTCA