Description :
From Genome Similarity Track
Location :
scaffold_1111:3328- 5571
Sequence
2243 bases(100 bases per row)
TGAGTACAAGGACAACATGTTCCGCCCAGAACTACCTGAAGGCTTACCGGAGAAACGTGGGATCAAGCTCCGGATTGATGTGAAGGATACAAATCTCGCG
ATGTACCAGCAGCAGTGGCGACAATCACCAGAACAGCAACGTGAAATTGTACGATGGGTCGTCGACATGGTGAAGAAGAAGCTCATTCGGCCAAGCATCA
GTCCACACGCCGCACCGACGTTCTGTGTTTGAATACCAGTCGGCTGGAGGATAGTCCATGACTACCGGTATTTAAACTCCAACACGGTGCGACAAAGCAT
CCCAATGACGCGGGAGGAAGACATCTTAGACGCGATGGCATGATCGTACTAGTTATCCACAATGAATTTGATGTCCGTGTATTATCAGGTGCGCATGCGT
GAGGAAGACATTAAGTTTACTGCCTTCCAGGCCCCAAACGGCCTCTGGGAGTACCAACTACTACCAATGGGAGTATGCAACGCGCCTGCAACAATGCACA
GACTCACGTCGAAGATCTTCCAAGACTTGAAGAACACGAAGTCGTTCTATGATGATCTACATCTTCACAAAGTCACCCAGAATCGAAGATCACCTGGGTG
TACTACGCGAGACATTAAACATTCTGCGTGAGAACAAGCTTTACGTTAAGCTTTCCAAGTGTGTCTTCTATGCCGAAGAGATTCCATGCCTAGGAGACTT
TGTTGGGCGAAACGGAGTGCGTATGGATCCCGATAAGGTGCAGACAATCAAACATTGGCCAGTACCACGGACACAAGAGGAGCTGCACAGCTTTCTTGGC
CCGGAATACGCCTCGCTAACATCATCAATGTTACCCTGCTGAAGAAGAAGAACAAGCTCAACGCGAAAGTTCACTTCAATAATGAACTACTGAAGAACTT
TAAAGAGTTGGAGCGACGGCTGTGCAACCCACCAGTGTTGCACCTGCTAGATTTCAGTCAACCAATGCATCTTCGTACAGACGCTAGTAAGTTCGCTGTC
GGTGGAATCCTATTCCAAGTCATCAATGGGTTGAGCGCCCTATTACATACACCAGTCGCAAGATGAAACCCGCGGAGCTCAACTACCCAACACAGCAACA
GGAACTCTTGGCAATCGTCGATGCGCTTGCAGCCTTTCGGATATACTGCTTAGACAAACCGCCAGTCGTCGAGACAGATCATAAAAGTCTTGAGGGTTTA
TTCACTCAGAAGATGGCGAATCGTCGTTTAGCGTGGTGGTATGATATCATCACAGAGTATCAACCGACGTTCTCGTGCGAAGAACGGAACTGAGGCGAAG
GCCCGATCTGCAACCAGAGACCAAGTCCTTCCACGACTTGAGCTTTATCGGTTTCAACGATACATCATTCAGCTTGGCGATAATCGACGTGGCCATGAGC
TCGGACACCATCTCGCAGATCAAAAGGCGTACAACAAGGATCGAGAGGTAAGGACAATCTTTTCCGCGACCAACCTGCGCTACACAACCCTGACACACGA
AAAGCGTAAACAGCATCGGAAGTTGTACCGATGCTACCACGAGGCCCACGGCTTGTTATGGTACCAACCCCCAGCGGATGACAAGCCACGAATTGTCGTG
CCCAACGATGCGAAATTGAAGCAACAGATCATTCGAGAATGCCACGACGCGAACTATGGAGGACATCCAGGGACTGAGAGGACGTACTTGACGCCAGTGC
GCCATTGGTATTGGTCCAAGATGTTGAAGTCGATCCAGAAATTCATTGCGGACTGTGAGCCATGTCGGCGGAATAAACCGAGGTTTAACAAAACTTGGCT
TGTTCGAACCCTTGGGCATCCCGGATGAACGCTGGCTGTCAATCTCGATGGACTTCATCACAGACTTTCCACAGACAAAGCGCGAAGTCAATTCCATTTT
GGTTGTCGTCGATCGCCTGACAAAACGTTGCCACTTCGTGCCCGCCATGACAATTGTGACGGCAGAAGGTGTAGCACAACGTTTTGGCGATCACATCTGG
AAGTTACATGGAATGCCAACAAGCATCGTATCAGACCGAGATAGGAAATTCGTTTCCGGCTTTTGGCAACATATCTTCAAATCAGTTGGAACGAGGTTGA
GCATGACGGTAGCACACCGTGCTCAAGGCGACGGACAGACAGAGCGAATGAATCGCACACTCGAAGAATACCTACGTAGCTACGTTGGGCCACTACAAGA
TGACTGGGTTTTACATCTCGCGAATGCTGAGTTTGCCATCAAC