Description :
From Genome Similarity Track
Location :
Scaffold_1253:3327- 4390
Sequence
1063 bases(100 bases per row)
GGCTCGTTGGGGCACGCCGTTGCCCAGTGACCTGGCTGCCCACAATGGAAGCACACACCGCTGTTCGGCTACCCGTGTCGCTCGTCGTACTGTTCGTCCG
CGTCGCAGCCGTCGTCCTCGTCGCGTCGCGTCGCTTGTCGCCCCCAGCCTGCTTGACAGCCGCCTTAAACTTCTTGCGCGGTTTGGCGTCCGACTCGTCG
CCGCTCGATTCATCCGTCTCGTGCTTGGGCCGCGTCTTGACCGGTCGCTTAGTAGCCGCTCTGCCGCTCGTTGTCGCCTTCGCGGCCGCTCGCTTCCTCT
CCGTTTTTCGGGGCTCATACCAGTATTTGCCGTTCCAGACATGTCCTGGAGGCGGATCCCACGTACCAGTCGCCTTATTATAGACACTTTGAGGGTTAGT
AAAGAGCGCCACGTGCTCCATTTCCTTCGTGCCCACGACGCCTTCACTCGTGTCCACGTTGCTCAACATTCCGGCTGGCAGGCCCATGCCGCCAATACCA
GGTATCGTCTGTCCCGTCGTTCCAGCCATCGATATCAAGTAAGGCCTCGGCGCCTTTGCCCACGGCAAGCCGCTGTTCAACATTTCTTGGGCGACGTTAT
CCATCGGGTCGTCGATCTCCGTGGCCTTCTCCACGGCCTCTTCCAGCGTCTTCGGCTTCGGTTCCTGCTGGACGAGCTTCCGCGTGGTCTTATCCAGACA
CCGATAAAATTGCGCGAGCAGAACGCGCTCATGCATGTTGTTAGGTCCGATGACGTCGCGCAGCCCAGCCGCAAAGTCTGCATACGTTTCTCCGGGCATC
ATTGGGCGCATGTTCACTCGCCACTCTGCCGCCGACTTGTCCTTGCGCTCGCCGTAGCGGCGTAGCAGAGCCATTTTTGATGTTCGACCAAGTTCTCTTC
TTCTTCGGCAGTCTTCGATTCATGTTGACCCACCACTTGGCAGCGTCCTCCATCAATTTGTTGCCTAAGATGTAGTAGAGCGCCGTATCCGACCACTTGC
CTCGTCCGGATTCTTCAGCTCCTTGGAGGACACAGATCGACACGATCGATCACGTCAAAACAG