Description :
From Genome Similarity Track
Location :
contig_45:332628- 334267
Transcript NameFunction/comments
g9515.t1XP_009515677.1 hypothetical protein PHYSODRAFT_473081 [Phytophthora sojae

Sequence
1639 bases(100 bases per row)
AGAGCCCACGAACGGGTGAGACCATCGTCCATGGTCGCTGTCGTGAGCTTCGCCAGTGCGTCAGCTTGGTTAATGACAGCCTGGTTCACAAGCAGCAGGG
ACAACCAGGCGTTGGTGGTGTCGTCACCCGTCACAATCGCCTCCTTCGACAGGATATCGTCCCATTCCTCCTGGATGAACGTCGCCGTACGCACCAGACC
ATTGATCGGTGACACAGGGATCATCTGAATACCGTGGATGCAGTACTTTTCGGCACTGAACCACGTCGCGTAGTCCGCCTTGTTGTCGAAGAAGATGCCC
GTGACGTGGTTGGGCACGAACTGAGGCGGGTGAATCGTGTTGTCCGACGTCATGAGGAAGTAGGTGCGCACTGCACGCGCGTTGAGGCGCAGCATGAGGC
TGCCCAGGTCCTCCACCGCCTGGTTCTCCGTCACCTTGCCCCACAGCATCATACCGTAGTAGAAGTTCACATCCTCCGACGTGCTCTCTTCATCCTTACC
ATCAGCCATGGGGGTCACACCGTGCGAGTAGGAGTGACCCAGAAACCAAGAGAAGTGGCGGAACTTGGGGAAGTGTGTGTCCTCCGAGCTCGGGTTGGCC
ACATCGCGGAGCAGCGTCCACACCATCGTCTCGAGTTGAGCCATGCCTGACCATGTCGGATCCAGCTTTTTCAGGATGGCCGACGCTGTGATCCAGTAGC
CGTAGTGGTAGTGGTGGTCGTTGTACACTCCATTGCCAAACTCCACATCTGCGTTGTTGGCGGGTGAAAACCTGGCTTGTCACAATGCCCTTGTAAGCGG
TCTCGTACCAATGGGACGCCAGCGTGTTGTCAAACGGTTCAACAAGGGTCTCCAGCTTTGACAGACAACTGCTCAGTAGCGTGGTGTCATCTCCCACCAC
TGAGCTGTCGGCGGCCATCAAACACAATGACGCGTATTTCTGGTACGCCTTGCCGTTGAAGTACCAGCTGCCAGTGTCCAAGCTCCAGTCACTGTCAATG
TCGCTCTGCAGCGTGGCGAGAAGACCAATCTGCGAGACCACGTCGGCAGACGGCTTGTTGGCTGGGTAGAAGTCCACCTCGTCGTCCGCTTCATCCTCCG
TCAGCGTCCAGCTACCGGACGTGGTTACCTGACCTACCATTTGGCCACGCGTGGCCGAGTGCAGGACAATCGCTCCACTCGACTGCGTCGTAGTGGCATC
ACCCATGGCCTCCAACTGGTGTGGCAGCGCGAAGTGCAGAAGACCTGTGTTGTCGCACCCACTGCCTTCCGTCTCCCACTGCAGCGAGTAACTCGTGCGA
GACTCCACAGACACGTTGCCGCCACGGATGATGCAGGATGAATAGTCGTCATACGCGCTCTGATCGCCGCTGTCAGGAAGGATCGCCACACGAAGCGTGC
CTGTGTAGGCTGCGCTGGAAACCAGCGCCGACCCGGTACTATCGATGGAGAAGGACGCGCTGGAGTCGCTGGAGTAAACCACCCACGTCTGGTTGTTCGG
CAGTTGGATGATATACTTGCCTGCGGTCGAGTCATCTACCATTGTCATGGCGTATTCGGACTCGATGCTTGCGGTGAGGCCAGAGTACGTGGCCGAAACG
AAAGCCATGCCGTTTACGAGAGACGAGTCCATGCAGCTC