Description :
From Genome Similarity Track
Location :
Scaffold_206:33262- 34669
Sequence
1407 bases(100 bases per row)
GCTCTCTGTGAGATTCGCATAGAGCCTCACACGAGATCTAGAATATCGGTACCCATATAAACTTCGAGCGACTGTAGCGTGTGGCTCCCTATCGAATGTG
AGCTCGGGGATCCCCCCCCTGCCATTCCACAATGGCTCGCAGCGTGCGAGTTGGAAGAATTTTAGCCGGAATCAGTCGATGGTAGATGGACAGACGCAGC
CAGCGACAACAAACTAATCCCAGGCTGCATTCGTCTGTAACACCGACGGGTTCACAACGTAAGTGGTAACAATACGAAGCGATCTTTAGAGGGGAGGGAT
CACTGACACAGCGTATCTGAGCTAACAGATGAAGCGATGAGATTCAAAGACGCGTGGCATTTCCTCCTTCGTGGGGGGGGGTCTTCAAAAGCGACCCCTT
CGCGTAGTCTGGACAATCGATATCGGTACATCCCTCCTGGTGGAAGTATAAAGAGTGAAGAAGGCAAGGATTTCTTTCTGGGCGATGAAAACCTTCTGGA
ATATTTCGCTTCAATCGTCATGCACAAGCTGCCTGGTATTGGTGATGTCTGAGTTGCAGAAGCGTCATCAGAGCGTTCTGATATCCAAAATCGTACTTCG
GTTGCTGAAATAAAAAGTGTCAGTTGTGATGACCAGTTCAGGGGCGATAACATGGCGATGATGAGTGATGCAATTTGTGGTGTGAATAATGTTACGGGGG
ACGATCTGGGTGAACAAGTTGGTGTGGAGAATGCAATGTTCATTTGGGCGCCGGTGATTGTGATAATTCTGCTACGAGAACGGGAACAAATGTCATGGGG
CATCTATGTCCAGTTTGTAGTTTAGGGGCTCTGAAGTACGCAAATGTACCTACGGTGGAGTTCCCATGCATCACTTTTGCTCACACGACGTATGCAGGGC
TCTTGAACTCCGTGACGCTGATGACCAAGCCGTTGAAGAGTTTGGTGATTGCTGCTACTGCAGCTCGAGTTGATATCGAAAAGCAGCAGCGATTCAAGAT
ACGGTGACAGGCATGTCACTGCCAACAACGTCCACAGAAAATCGGCTTGGCAGTTCGGCAACGACCCACAACCGTAGATCTCTACCGAGGGCGATAGAAG
AAGACAACGCTTCAGTTGCCACACGTACTGCGATCAATGCACAGCACAAGCCAGTGCAACTAAACGCCAAACCGGGTATTAAACTTGTGACTCCTGTGGT
GTTGTGATTCACAGAAACTTCGTTAGTGCGGCTTCCACGCAACAACACAACAATTCGCCGAGTCAGGTCGGCATTGTTGGTCTTGCGCAGGGTTCTGTTG
GTTCCCTTTGCGGTTCGGCCCAGCCGGGTCCAGTTGAGGCCCTGTTCTCGCTGGGTACCAATCCAAACTCCAGAAGCTCGCCTGAGCGGGGCAGATTCCG
TTCCTCA