Description :
From Genome Similarity Track
Location :
Scaffold_366:33260- 34507
Sequence
1247 bases(100 bases per row)
CGACGGTGTAGTTGAGGGCTGCTCGACTTGGACCCACAACGGTTTCTTCTCGTATGTAATGACCGTTCGGATTTTCAAAACACAAATCAGCCGTTATCTC
GAAAACTCGGATAGGTACGAATACCGATGGTTCAACTTTGAAGTCGattatctcgataactcCGAATGGTTCATTAGTGTCATGTGATATGACACCGTCT
CATATTACTACAGATATTAGTATCCAAAATGCGGTATCATCTATTCCTCCATCGTGAAAGTGTCAGTAGTACTATATATATACCGATTTTTGAGCGTACT
ACTAATCCCTGATCACCTCGAATGCTGCTAAACCACAGCTGAGATCCCAATAAAATTCGAGCCCGACCAAACGAAACACAAGCTTGACTAGCTGCAGACT
GTCTGAAGCCAGACTCCGTCGAGTAGACGAGCGCTTCCGCTGAGGATCGAGTAACGCTACCAAGGAGGAAATACCAAAATCACTTACAGAATTAGAGGTC
AGCACGGATAGTCTGCAATCGGCACCAACGGTACCCTAATCTATATTGTTCATCTGAGACACGCGGCTGAGAGCGTTATGGGGTCCGCACAACACAATTT
gcgcacaagcagcaacgtgtcGGCCGCGACGGCCAGCAGGGACACAACCCGGCGCCACACTACGTGTGCTGGCGCCAGCATCGATGAACGGCAGCCGCGA
CGGCCAGCACCAGTAACCGCATGGCGCCGTACTGCGTGTGTGAGCGCTGGCCgcgacctccagcagcaacgacggccagcaccagcaacaatGTGGTGCC
GCACTGCGTGTGCGAGCGCCGGGCAcaacagccagcagcgacaacagccTGGTGCTCGCCGCGACGGCCAATAGCGACAACAACTCGGTGCTCGCCGCGA
CGACCAATAGCGACAATTTCCCGGCGCCACACCGTGTATGTGGCCCCCGGCTTCAACGGACGGTGGTAGTAGTGACAAGAGCGACTACAAAGGGGGGAGA
TGCTGTCCGCACTAAGGTaatgtactgtacatggGCTCTGTCTTACATTCATTGCAACACCGTACTAACTAACACAGTGTGTGTTTTCGTGTACATGCAT
TAGATAGATATCAATAATAGAGGACTGTTCTACTGCTGGATGCGTTGCATTTGCTTTCGAATCTCGCCTACCGTGCGAGTTGAGGGTGCAGCACCTCGGG
TGGCTTCTGTACCGTgcgagttcaagaagagGAAAAAGGCAAACAAG