Description :
From Genome Similarity Track
Location :
Scaffold_438:3326- 4531
Sequence
1205 bases(100 bases per row)
TAGGGCTACTGTAAAGGGGTTACACATCGTAGGGTACTCGGTACCCTGTGTCTTAGACGCATGGGATGGTATCCCATTGAAAGAGATAGAATATCTTATC
CATTTATAGGGGCTGACGGGTATGAGCCACGAGATAGGAAAGATCTCGAAAGTTCTTGGTTTAGGACATGAGTGCCTAGATTAGGTAATATTAGGATTAA
GATATTCTATAGAGGTAAACGTAAATAAAGTTCAGTCCCCCTTTTGATCTTGTCTAAGACACGTGCCTTGCGAGGCGTCTCGGATCGTTAAGAGTTAGCA
CATCTCGCTGAGATAGCTACTCTTGAGCATTAAGTGCTGTAGATTCACTGAATCGTTCGGTTCCCTGGAACAGGGACCTTAAGCGTTACGCTTGTTGACT
CATATAGTTTAGTTCTTTGTAACTAATTTTGCTCCTTGAGCACTATGTCTTCCTCTGACTTAAGGAGCTGTGCAGCTCCGCTACACTTGGTAGCACTTGT
ATTCAATCTACGCCTGAGTCTTTAAATACTGATCCTCTGTGAGGATGGAAAACCCCACTCCCCTCTCTGAGGCCCAAAAGGTCGCGCTTGATAAGCTGAC
CGCATCTTTGGGTCCAGATTACGTGAAATTCCTTGTATCGCAAGGCCCAGAGGTCCTTACTGCACGTTCTGAGGGCTTCTTGCAGTATGAAGCGTCCCTT
CTAGGACAGGTCCAAGACCAAATGGCGTCGGCTATGCCTACACCCTATGTGTCTGTTCCAGACGAAGATGCTAGGATTCGTCCACTGAGAGTGGAAGTTA
AAAAATACTCAGGAAAGAAGGGTGAAAACCTCATCCTCTGGATCCGTGAGATTGAGATGGCCATGAGATCAGGCCTGATCAAGCTTGACCATCAACAGGT
CTCGCTGGCTATCTCAAAGCTCAATGGAAGAGCTAGAGAACGGGCCTTGACGTGTAGCACGTCGGTCGACTTAGCGTTTCCCACATGGGAGTCGCTTAAG
TCACAATTGATACAGGTGCTTTCACCACCTAACCAGGCTTACCGCGTGCGTTCACGCTTTTTATCAACCCGTCAGGGTAAGAATGAGTTAACGGACTATG
TCCAAGAGTTGAAACCTCTCATGGCTGCTATGCAGTCTGACCCTCTGCCTGAGGCAGTCCATGTGACTATATTCATGGAGGGTCTCCGTACTAGCATTGC
CAGAA