Description :
From Genome Similarity Track
Location :
Scaffold_198:33246- 34463
Transcript NameFunction/comments
Pytul_var.sporangiiferummaker-pug3_contig_198-snap-gene-0.28WD repeat protein 6.

Sequence
1217 bases(100 bases per row)
ATTTGCCTGGACACTTGTACGACACCACGAGCTTCATGCGCAACGCCGAGTTTTCATCGACCGCTTGCCACTCCCGAAGCGTACCATCGGCACCACTTGT
GAAGAGCGAGCCATTGGCGTCCAGCGACCCCCACCAGAGCTTCATGATGCGTGTTTCGTGCGCCTTCCATAAGCATTTCAGCGTCGCAGTCGCGATATCA
ACGATCGAGACAGTGCCAGTCGCGTCTCCACCGAGCAGCATTCTGTTGCTTGTGTCCATCGTGAATGCGGATAGGTTCGCCGCTCGCGAGTGCTTCTTTT
TCTCGCCCTCAGCCTCTTCTTCTTGATCTTCGTTACCTGTACTGCTTAATCCGAATGCGTAGAACAATGTCGACGTGTTTGCTTTCAGGTCAATTTGGAA
GATCTGACCGAGTTCCGTTGCCACAAAGCCCACGTCTCCGCGGTCACTATTCACGACAATGTCACGAATGCTGAGCGTGTTTTTGCTCTTCTTCTCCGAC
ACGAACAGGTGCTTGTTCTCGTCAGTGTACAATGGGATCGACTTGCAAAACGCGTGCGTAATGGGCGACGTGCACTTGACCTGACCACGCAGCTGCCAGA
GTTTCACGGCACCATCGGTACCTCCCGTCGCGACAATCGACTGCGAAGGATGCACGGCCACGCGCCACACGTGCTTGCCCATGTGGCCCTGCAAACTCGC
GATGCAGTTGCCGGCAAAGTCCCAGATCTTGCAGACCGCGTCTTCGCTCGTGGTTGCGAGACCAAACGCGCAAAACTTGACATCCCAGAGGCGCGCCAAG
TGGCCCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGCGGAACACTGAGCGGAATTCTTTCGATAACACGGCCTTGGACGACGCGTCATC
CTCAGCAACCGTGGACTGCAGCTTGCTCATGAGCGCCAGCGTGCTCTCTGTGGTTTGCAGGCAACCACTTGCCGCAGTCGCACTGTCAGCCTTATCAGGA
AACTCGATGAGATCGCGGTTCGACCAGAGCTGAACCGTGCGATCGTCCGAGACCGACGCCAGCATCGACGCGTCGCTGGACCATTCGAGCTTGAAGAGCA
CGCCGTCGTGGGAGTGGAGACGCTGCGCCGGCGCCACTGCAGCGTTCTCGGTAGAAGCCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNTGCTGGAACACCGT