Description :
From Genome Similarity Track
Location :
Scaffold_17:332353- 340292
Sequence
7939 bases(100 bases per row)
TATCAACCTATAAATATACTCAGTTTACAATCTACCTTATTTAGGTCACTTCACTCTCTTTTGAATGAAAAGGGGACCTGTGAACTGCCGTTCACTAAGA
GTTTATATACTCTCGGAAGATAACTTCCTCCAGCGCAAGGTGCTATGTGACCCCGTCGCACTTGGTAACACTCGTAGTCAATCCACGCCACCGCGGGATA
GACTACCTGAACCTCTCCGAAGTTTGTTGCCATGGAAATGAACGACTTCTCCTATCTGAACGACTTACAGTTCGAGACGATTTGGAAGATGGCAGGTATC
TTTGGGATGGAGGCCCTGCAGAGCCGTGTCAGCACCGGCCAAGCAGCTCGAGCGCGTCAATGCGCTCGACGCGTACGAGCAGGGCCTCATCGCGCTGGTG
CGGGAGAACCTGCAGGCTCAGGCGGCGGAAGCAAATCCGCCTCACCCGAAGCCAATACGGCTGAAGGTTAACGCGTACAAAGGGAAGGAAGTCGAGAACC
TTCACTTCTGGGTCCGAGAAGTAGAGCTCGCGATGGACGCGGCTCTGATCTCGACTGAGCAACTTCGTGTTGCTTTTGCACTCTCCAACCTTAGCGGCCG
TGCTAAGAGTTGGGTGTACACACGGGAAGCAACATCCCCCGGATGTTTCACATCCAAGGATCAGCTGTGTGAACAGCTCCGAACCGCGTTCCTCCCGGCG
AACTACGAGTCCGCCACCGTTCGCGCTTCCTCTCGTGTAAACAAGGGAGGCGCGAAATGCACGAGTACGTGCAAGAGATACAGGAGCTCACGGCGTCTCT
AGTGGGAAACCCACTCAACGAACACATCAAGATGACTGTGTTCATGGACGGCCTTCGAGTGGGCCTCGCACGCACTCAGCTGTTCCGGGTGCAGTCAAGC
ACCCTTGAAGAGGCGATTCAAGTGGCTCTTCAAGAAGAGAACAGCCATCGCCAGGCGCGTAAGCCGGCCTCAGCATGGCCTGGGAGTTCCTTGTCGGCTC
CCGGTTGAACAAGCCCCAACGGACCAGTTCCCATGGAACTAGGCCCGCTGAACAGCGTGACATCCGCTGCTTTGGCTGCGGGAAGATGGGCCACTTCAAC
TGCGACTGCCCCGAGGAAACCCTCCGCAGACGGTCCTTCCCCAAGCCCGTCCTCAAGGGTCGCTGGTAGAAACCAGGATCCCGGGGACAGGAGAACGCCG
GAAATTAGTAGCGGCGGGGCACCCTACTGGGGAAGAACTAAGTTTTCGTGAAGGGTGCGCGGGTGGCGCGTACCACGAGGACCGAGCCCCTGAGAGTCTT
CGCACTCTCGAATCGGCGAGGAGCAGCGGCGGGTTGCTCGTAGTACACGGATGTGTACGGGGATACGATCACCCCTTTAGAATCTTGATCAATTCTGGGC
CGTCGAAGAAGTTCACACGCCGCCAGACGGTTGCTTGTAATAGCAACAAGCTGTCCGATACTTTGAGAGAAAGCAAGGGCAACGGGACGGTATCAGTGTG
ACTGGCCGACGGGAAGGTCGTCACTGTCCCCAACGTCCAAGTGGATCTGGCCGTCAAGTTTGAAGACTTTGACAGCCTCGAACAGCTCACTGTTCTCGAT
ATGAATCCATATGATATGATCCTGGGCATGCCCTGGCTTGAGAAGCACGAGCCCTGGATCGACTGGCGAGGCAAGGCAATCGGTGCCAGCCGCCCTGCGC
AGTCCGACAGAGCATTGGTGAGTCATGTTCCCACCTCTGTCAGGACCCGAGGCAAGGCAATCGGTGCCAACCGCCCTGCGCAGTCCGACAGAGCATTGGT
GAGTCATGTTCCCACCTCTGTCAGGACCCGGGGCGCCCGCAAGGGCTGCCAGGGTACCAAAGCATCCGGCAGATGCTTGGGAGTCGTCGACGTATATGAA
GACTCCGAGGATGTTTTGATGGTGGCAGCGCCCAGAAGAGGCGCTGGCCAAGTGGGTAACTCAGGTCCACAGGCGGGTAACTTAGTTCCGCAGACAGCTA
CAGCTGTCATGAACACTGAGAACAGCGTGTTCAGAGTGGGTAACAGAGTTCCACTCACGGTCGCCCAGACCTTAACTGAAGAGGAAGACGTCGGATACGC
TTCTTGTGTGTGTAACGCTGTACCACACGAGGTCTCGAGCGCCTCGGATGTCGGCGCTCCGACATCCCCAGACGTGGGTAACAAAGTTCCCCGTCACGGT
TGCCATCGACGACGCCGCCGTCGCCGAGAGTCGGATCTGAACCTCATTCGGATCGACGTCGCTTCAAGTGCCTCCAAGTCCAGGGACCCGTCAAGGCATC
TGGTGTCCACTTGGAACCGTTGCCAGAGATCGCAGAGATACTGAACCTCGAGGAAATGACGGTCGAGTCTTTCCTGGCCAACCTCAAGGCTGGAGAGATT
GCTAGGATGGTGCTCATGAGACCTAAGACCACTCGAAAGGAGCTGAACACCTCCTCTGGCTTGGACGAGAACGTCCTGGAAGACCTAAACAAGCAGCTTC
AGACGCGCTTGGGCTCTGAATTCCTTAAGAACCCCAATGATCCGGTGTATCCTTTGGTGACGGAGTATGCGGACGTGGTGAACAAACACCCGCCGACCCA
ACTCCCACCGGATCGAGGCGTACGGCACGAGATTGATCTCGTGCCCGGCACAAAGTATTGTGTCACGAGGCAATGGCCTCTTCCGCGCGAGCAGTGCGAG
GTCATTGATGCCTTCTTCGCCGCCAAAGCGAAGGCAGGCATGGTGCGGGAGTCGAAATCCCCGCACTCGACGCCGACTTTCTGCGTTCGGAAGCCGAACG
GAAAGTGGCGTCTGGTTCACGCTTATAACAAGCTGAACAACGCAACGGTGCCGGCCCAAACACCAATCCCACGAAAGGATGTGTTGTTGAACAACATGGC
CGGGTGCGTACTGTACAGTGCGCTAGATTTGGTAAACGGATACTACCAGATCCTGATGCGCGAGTGCGACATTCCTCTCACCGCGGTTAGCGCTCCAAGC
GGCATGCTTTGGGAGTGGCTTGTCATACCGCAGGGCTTGTCTAACCCCCCCCCCCCCGGTGACATTCAATCGCCTGTTGACGCAATTGTTTAGGCTACTG
CGCGCCTTCGTACAGACGTTCATCGACGACATATTCGTCCATAGCCGTGCCGAGGGAGGCAAGACGGCCATGGAGGTGCATCTAGGACACCTCCGTCGAG
TGTTGGACGTAATGCGAGCGAACAAGCTCTCCACCAACATCGACAAGTGCGTTTTCGCGTCACCAGAGATTAAAGTTCTCGGTTGCTTCGTAAGCAACGT
GGGCGTTCGAGCTGACCCAGACAAGGTCAAGGCAGCATGGCCGACGCCCCGATCCCAGAAGGATCTTCGAAAGTGGTTGGGCTTGGCCAACTACCTTCAC
AAGTACAGCGCAGGGTACGCGGGCTTCGCTAAGCCCTTGTCGGGTCTCCTTTACACGGATGTCGACCGACGCTGAGAGCAAGAGGGCCAGGATGCCTTTA
AAAGTATCAAGGCCAGTCTCCAAGAGGCCCTTGTCCTGGCGCTGCCGGATGAGACGAAGTCATTTAGCGTCGTCTGCATTGCCTCCGACTACGCCATCGG
GTGGGCACTGCCGCAGGCCGACACGGCTGGCCATGAACGAGTCATCTCGTTCCAGTCAAAGCAGCTCAAACCCGCCGAACGGAGCTACCCTGTCCACGGC
AAGAAGCTCCTGGCAATGAAATATGCCCTTGTGAAGTTTTGTGTTCACCTTCTGGGCTCGAGGCCCTTCGTGATCTACACAGACCACACATCCTTGAGGA
CGGCGACTATCTAGCCTCACCTCTTCCAACGGATGACGAGGTGGCTGTCCTTCTTCGCGGAGTACAACTTCCGCGTCGAGTACAAGCCGGTCATGCTCAA
CGTGCTTGCGGACGCCCTCTCTCGGCGTCCCGAATACGAGTTGGCCCACATCAAACGGGTGACAGCGGATCTATATGATCGGATACGCATGGCGTATCAG
GACGATAAGGCTGTCGCGCCTATCGTCACGCTCCTCACGGCACGAACGAACGAAGTCCGACTGGCTTTCGTCGCGACAGCGCTCCCGGCTTCACCGATAT
GAGTTGAAGAATGGCCTCCTCTATTACCGGGTGGAGCCCAATGAACCTCCACGGGTGGACGTACCCAACGACGAGGACCCGAAGTTCGATATCCTCGTGG
CGGCGCACGGCGCGCCCTTCAGCGGCCACTTGGGCCGCGAGAAGACCTTCCTGTCGGTCGCTCAGGTCTTCTGGTGGACTAGCATGTGCAAGTGGGCCGC
CTGATACGCGAAGACATGTGAAATATGTCAGCGGGTCAAACGCGCAGGGCACGCTTCCGCTCCACCACAGACCCTAACCTTCCGGCTGACTGTTGGAAGT
CGATGAGTCTTGACTTCATCTTTGGGCTTCCCGCCGACAGACACGCCAACACCGGAATTTTGGTGTTCGGGTGTCGGCTGATCAAGATGGTACATCTTGC
TCCAGCTCCCGTTCCTGCTACCGTTACGGGCGAAAAAGCCGCAATGTTGTTCATTGATGGCGTGTTCCGCTATCACGGACTCCCGGAGACGACTGGCTTG
GATTGAGACCCACGGTTCACGGCTGCGTTTTGGAAAACGCTGTTTCCTTTACTGGGATTTCTTCTGCAGATGTCCACTGCGGACCATCCACAGACAGACG
GTCAGACAAAGCGCGTCGATCGAGTTCTCGAGGACACTCTGCGCAGTGTGTGCGCGGAAGCACCACGTACGAGGTCGACACAGCTTCCGGTTGTTAAGCT
TGCGCTCAACAACGCGGTGCACGCGTCCATGGGGGTTCACACCACTCTACTTGAGCGGCTTCCGTCACCCCAGAGTGTGTCGCACTCTTCGAGGAGACGC
TGACTCCTCTATTTTAAGTGGGGGGTAGGCTCGGAAAGCTCTTTCCTCCCAGGTCTCAGATGTGAGATGTGTTTCGCTGCGGAACTAAGTGGAATTCTTT
GTGGATACCGTTGTCAGCAGGGTCCGCGATGTCATGACAGCGGCCCAGGCCAGACAAAAGAAGTACTCTGACAAACATGGAAGAGGAAACTTAAGTGTAT
TTAAAGTAGAGGACTTAGTGCTATTAGACACGAGGAACCTACCGCTAGACACTGTCAGATCTGTCGGGAGCAACAAGCTGAAGCACCGCTTCATCGAACC
ATTCGCAGTCCTGGCCAGGCATGGTGCGTCGTACACCATCGACCTGCCTAAGGTAATGACGACGTATATGACGTTCTATGTTGGACGTCTTAAGCGGTAC
TTTGATCCGCAGGGGGTTGCTGACTCGCAGACCCCCCTTGGCCCATCTCCTCGAAGCGAGGGTCGGCCACAGACGTCGACGAAGGCGTCGGAGCAGGCAC
CCAAGCCTCGGTTGGAGCGGCAAGGCTGCGGTCGAAACCGTACGCCGGAGGGGCTCCGTACGAACGGACCCCGGCGCCATACGCCGAGTACGCCGGGTAC
GCATCATACGCGTACGTCTGGGAGTGTGCCGCAGGAGGCTCCGGGCGTGGTAGCAGAGCCTCGATCCGTCGGATCGTGCGAAAGGCCTCGTCCAAATCGG
ACGAAGAGGCCCGGCGATCCACCCGCAGGTGCAGGCTCGCGACCTCTCGCTCCAACAGGTCCAGGCGGCCCGCAAGACGAGCGATCTCGCCCTGATTCCC
GGCCTGGGCGGCAGCATCACCGCGAGTTCGAAGGCCAAGTGCAATCTCAAGCACGAGGACACGTTGACGGAGGCGGTCAACCTCAGGGCCCTGTGTCGGA
ACCGCAGTCGAAGCACTCGGACGAGAGTGGCTTTTGGGAGGCGCCGAGTACTCGTACTCGTACGAGGGCACCTCCGCCCCTGCTTGACCGGAATGGAGAA
GTCCACTCCCACGTGGAGCGGATCCTCTAGGAGCAACGGCGTCGCGGTAAGCGACAGCTCCTCGTGAAGTGGAAGGGTTAGGCCCACTCCGAGAACCCGT
GGGAGCCGATTGAACGGCTCCGGATTGGCTGCCCGAAGGCTGTTTTAATCTGGGACAGACTGCGGCGACAGCTTCATAAGTTATCCGGGGCTTCTTGCCC
GAACGGGGTACGGACGATAAATACATTCCGTACGCGCGCTCATCGTGAGCGCTGGAAGCCGCGCGCGCTTCAGGATGTCCCTTGGCTGCATGCGCTTGCT
GATCAAGCGGGCAAACCTCATACGAAGATCACGCTGGTCCAGGATGCGAGACAGCAGCTGATCTTCATGGAGTTCCCGTAACTCCGTGGGTGAGTACTTA
AGAGACTCCACCCATGCCCAGAACATGTCCTCACAAGAACTACACGTGGAACAGCTCTCGGGCATAACCCAGGGGTAGTCCCAAAGAGGATAGAGACCAC
CCCGGGTCTCGGGCTTCTTACGACAAGTCGTGAAGTCCTTAAGGGGAATGCGGTGTGGCGCGAGAAGCAGCCTCCAAGTTGTCAGCGAACAACTGTTCTT
TCTGAACAAGGGCTCGTTCATAGATGTCCTTAGAAGTATGGCCGCCCACAAGGCCACAAGGAGTGACAAGAAGCTCTAAGAAGAGGTCGCCCCAGAGCTC
TCCTCGGGAGGCCAATACCCTCTTGAGTTGATGGCAGCTCCCTGGCTGACGGGTGCCGCCACCGAACCCCCACGCACACGCTGGGCAGCTTGGAATTCCT
CCTGCTGCTGGTCGAGGTCATTCGCGACCTCCCGGGCTCAACGATAGCACCCTCCTCCCCCTCCTCTTATTCCTCCTTCTCCTCCTCTTCATCCGAGGAG
TCGAAGATACTGTCGAGTCTCCTTCTCCTCGCGGAGTGGAGACTTAGAGGCTGTACGCTTCTTTGAGGGCTTGGCGCCTTCGGCTTTAGAGGCCTTAGCA
CGCGCAAGACCCTCGGCAAGCGAGAGACGTTTGCGAGGATTCTCTTCCTCATCGCCACCGGCTTTGGGAGTGCCCTTAGCCTTGACGGCCGGACTCTCAG
AGCGCACAAACGTCCTGGGACTGTGATCACCTTGATCACTAGCAAGTGACTGCACGCTGTCATCCTTGTGCTCACTGCACACTGGGCTGTGCCCTCCCGC
AGAGCCCGCAGGAGCATCGTGCGTGCTCTCGGACTCGGCTTCGTCCTCACTACCAGAGTTGAACTCACGTTCTACGAGCCGAGGGTTCGGACGGTTGTCT
AGAGAAGCCGAGGGAGACGGGCTGCGGCACTTGCTTGCTCTCTTGCCCACAGCCGCGTCACCCGAGGAACCGATCGCCTCGGAGGCCACCTGAGTAGCCT
CCTTGAGTGCCGAGCCTTTGCCGTGAGGCTTAGTGCTCTTGGCTTGCGCCTTATCGGCAGCAGCCTTGGAGCGTGTCTTAGCACCGCTCTTTGCTGTGCC
ACGAGGCATAGAAACGGTCGAAGTGGAGACCTAGAAGAAGAGCTCACAAACTGCTGCTCGAGGCTCTAACTGTGAAGTGAGCGTCCGCCGCGCTCGCGCG
GCCAAGTCGATGGTTTTCGACTTTGAGAATGAGAGTTTGTGACGAGCACCTCTTCATTCTGATTGGTCGGTAAACCGAACCTAAGTGGGGGGGGGCTGTA
ACGGGGTACGTATCCCTAAGTGTACTCTGGTTACATGAAGTGTGACACTTCGCACTTCAGGAGTATGACACGTCATACTTCGGGATTTGGTACAAAGTAC
CAAGGTCGTTCAAAGCCAACGATTGGCTAACGACATTGCATTTCTATAGGTGACTTATAGTTTGTATTAAACCCAAGCTTTATCTACCTATAAATATACT
CAGTTTGCAATCTACCTTATTTAGGTCACTTCACTTTCTCTGAATAAAGAGGGGACCTGTGAACTGCCGTTCACTGAGAGTTTGTAGACTCTCGGAAGCC
AACTTTATCTAGCGCAAGGTGCTGTGTGACCCCGTCATA