Description :
From Genome Similarity Track
Location :
Scaffold_15:332346- 338282
Sequence
5936 bases(100 bases per row)
ATCTACAGTGTCCATGGTGAGAGCAGGGCTGCCCATTGTCCCAACCGTCCTTGCAACCCGGCCGACTTAAACAGCCAGGCAAGCGTAGAATGTCGCGTCA
GGATCCGGATGGATCTCCCCACCAGCAGGTTATAATTGAGATCCAGCACCCGTAGAAGTGCCAGTATCTCCTTCTCCACTGCTCCGTAATTCAACTCGTT
AGGCTTTAGCGTTTGGCTGACAAAGGTAACCGGATGACAGATCCCCTCATGCTCTTGTACCAAAGCTGCCAAAATCGCTCAATCGCTAGCATAGACTATC
ACCGTAGGCTGACGTTCTGGATCAAATGGCGGAGCATGGGTGTTGTTGCGATCCTGTCCCTTAGTTCCACAAACGCATGGTGAGCTCGGATCCATCGAGG
CTCCACTTTGTCTGAGATCCTTTCCGTCAGCTTCGTCCAGATCGGATCCTCTCCTAGCTGGTCCCGTCCTGGATCGAGTTCTTGCTTCAGATCGCCTCTC
GACGTCGTGCCATGTGGATCCCCAATTCGATCTGGGATTTCCAGGGCCAGAGCTTGTTGGATCTTGGTCCGGATAGCCAAAGTAGCCATGGCAGCAACGT
CCACCTCTCTTAATTCATAGAGGACCGCAGCGAAAAGTGCGTAATTCTCAATGAACCGACTGTAGTAATTCAAACTGCCCAAGAAGGATTGCATCGCCCG
TGGCGACCGCGGAAAAAACCAATCTGACAACGAAGACAGATCTTTAGGATTCGCCTCCAACCCCTCCTTAGAGACTCGATGACCTAAATGATCTACTTTG
CGCATTTCCCAATAACTCTTCACCACGCTGATAGAGAGATTCCGTTAGTACACGTATCCAGTAGGGATGTCACTCTCTCGCACAGCTGATCCCACGATTC
CGCCAGGATTAGAATGTCGTCGATATAGGAGCTGCGCCGTACCACGGATGGTATCCCCAGATCGCCTGGCTCTCCTGCTTCAGAATGGATCCACTTCCGC
ATCACCTTCTCCGGATCCACCCGGATTCCGGTATTCGGGTAAATCCGTGGAGGGCATTATCAATCAGACGTTGATAGATCTGGGGTGCGTTTTCAGTCCA
ATCGACATCCGATTCCACTCGAACAGTCCAAATGGTGTGATGAATGCGGAGATCGCGCGAGCTCGATACGTCATAGCCACCACCCAAAATCCACGCCATA
TCTAGGGAGCAGTACCAGAGTACTTTATTCAAATCGTTTAATAGCTCATTGAGTAGAGGCATCGGATTCACCATCAGTCTGGTCAGACCGTTAACATCCG
GTAATCAATACCCAGACGTATATCCATCCCGTTCTTCTTTAAAATCGCCACTGGAGACGCCCACCGGAGGTTGAAAAACTGATGCTTTGGCTTGTAACAG
ACCTTTAATCATATCCGAGAGCTATTCTCGGAACTGAGGTGCCACCTTCCGCACCCTTTGAGCGATCGGCTTCGCGTCACCGACATTGATGTCACAGTTG
ACTGCATTTCCTTTGCCAATTTGCGGATGTCGGCTTTCCCAGATTTTCGGACGTAGTCGGTCCACTTCTGCGGGTTCGTTCGCTCCCGGATCCACCTGGA
TATCATCAATCGTGACTTCCTCTGTAGTCAGTGGTACCTCCGGGATTACCGCCCTACCTTCCCAAGATATTCGGCGTGCAGATCCTCGCCTTCATGGTAG
CATACTTGTTCGTCCTCAGTATTTGTCGGATCTACCACTGGATCCAGGTACCGCAATTTCCCCTCTTCGGTCATCCCTTCTGTTTTCATGGGATCGGGTA
TTCTGGTACCGGGAGGAGTGTCTTCTGGATCGACTTCGGTTTCTGGTATACTTGTACACGACAGCTCTTGTTTAACCAATGTCGACACTCTTGACAGGGA
TTCAGAAATTCGGTCCAACGGGAAACTCGGATCCAACTGCGAATTAGCAGAATCCATCGGGCCAGGCTCAATCATTTGCGATCTTCCATCCACCGACCCT
TGGTTACCTGGGAATCGGCTCTGGGTATCTCCAGCTGTCTCGGATCTAGCCTCGGCCACTTGGATCCCAATCCGACGATCTCTCAGTAGGATCTTTCGCG
GAGTTGGATATGAAGGTCGATCCACCAAGGGACCAGTCGGCTCCGCCGGGGGTTCCACCTCCCCGAGAGATTCAATCTCGGTAGTCGCTTCATACGCCAT
ATTCCGCCATTCGCTATAGCGACGAGATCCAACTGACACATATCCAGGCCGCCTAGGGATACCATCCTTCGCCAGCCATCGCCCAATTTCTTCATAGTGG
TCAAGTAATAACCTCTTGTCGCTGACATTCGTAACTTGAAGATACTGCGATCGACCTGGTCCTTGGATTACTGTAGGCACCCACTTCTCGCCCCGGGTGA
CCCACCGTTTCTCATGTTCCACCCATTTCACCCAATCTGGCAATTCCCAGGTTTCTCCGGGCTCGATCCAGGTCGTCATATCCGCCCTTATGGTCCTCAT
CTTCGACCCGTACAACGGTCGTCGTCCACTGAGCTGGATCCGCATTTCATCCAGGAAACACAGTGTCCCATCTGCCAGATCTAACCCTACCCCGGCTGGT
ACCATGAAATCCATCCCAAGAATAGCATCTTGACTAGCCAGGTCTCCGACCCAAATGTCGAACCAATATTCCAATCAACCTGCCAGCGTGATCTTGATTC
GCGTTCTCCCATTCGTACGGTACACGCCTTCACCAATCCCAACACAATTTTGGATCCGACTCCCATCCACTTGGCACCCAACCTTACGAGCAAAGGCGGT
ATCCAGTATAGACACCTCGGCACCACTATCTAGGAGTAGGATTGCTTTTTCATTGTTGATCTATCTTGCCTCCTACCATGGCTTGTCGGAGCCATTTTCC
TGGTGCATGGTACTTCCAGTATCCATGGGACTCCCCCGTCAGCAGATCCATGGATCCAATCTCTTCAGACCCACGGGATCCAGTGACCTGACCAACCTTG
GGTGGATCTGCACTGACTTCGCCCTTGGTAGGCTCAAACCATCGACCATGTTGTCGTTTCTCCCAATAACCGCGCGCTTCTCCCCTTTGTAGATCCAGGG
TTGAAGAGACTTCGGATCTGGCAAATTCATCCACTTGGCGCAAACTAGAAATATTGGCAACTGACACTTCATGTAGATCACGTGTATTATCGACTGGATC
TAGGAGCCTGCTACCTGGATCTAGCGACGTCTTGTTCACAAAGGCATGAATGCAATACCTAGAACGCTCGGCTCGTACCGGATTCGAACCCGGCGAGCGT
CCAAGTTAAAATCCTCTCTGCCGCATCTGGCAACATCCCTCTGTGCTTGGCTGGATCAAACCATTGGCGGATCTGGTTGTAGAACGCTTCCATCGGGCAC
TTGCCGGTGTCGTGGATCTCGCCACAACCACGACACACGTAGAAGCAATGATCCCCGGGATGACCCTTCTTGCCACTTCTCACAAACCAGATGGTTCCAG
CATCCATATTCTGTGTGCTTCCGGGATCCGCACTGCGAACACCTGATTTGCGCTGTCCCGTCCATGAGATCTCGGGATCTGTACGTCCCACGGTCCCCGG
GTACGGTATCCCCCGGTCGAGAGTTGTCTCCGGTCTTCGCCGTTCGATCGTTGGACGTAGTGAGACAGACTCGACGGTAATCCTCTGGGTCGGAGTCCGA
ACCGTCGGATCCTGATTCAGTTCCTGAGTCGGGCGCCGTGACTTGGTGGACTCGTCGAGCTGGAGCCGAGGGCGTCGGGGCTTTTTGGCGATACTTGCCG
GATCCTACCGCCGCCTTCTTCTGGCGGTGTTTCGCACGATCCACATCCCGCAGCACTTCTTCAAGCTCATCGGCGTCTGAAAGTCGTAACAGGGTCAGCC
TGTCGGTCAGATCCACGTCTCTAAATGTCTCGATGAAATGATCCACGTGTTCCCGTAGTACCTTGGATCCCCCTTCCTTGATCTTCAACTTGGCTCGTAG
ACCGGCCACATTAAGCCGATGAAAATATTCCAACGGGGATTCGTCGGATCTGCGGCGAGCGTGGAAGTATAGTCGTACCAGTGACACCCCCAATCCACAG
TACTGGGTTTGGAAACTGTGCAGCAAATCCGGCCACTTATTCCTGGTGGATCTGCTCAGCTGTCGATACCAGTTCCTGGCTGGCCCCGCTAGCAGATCCG
CAAAGGTCAAAAACTTCTCAGCATCCGACGCTTGATCTCTCATGAGGGCCGACTTGACTTTGCTAATCCATGTTCGCGCTCGGGCTTCGTCTTGATCCTT
GCCCGTGAACTCCTTCAGATCCGATATGGCTGAGATCTGTACCTTCTGGATCATGGACGATCCACCCGCCCCGGCTGCGGCTGTTGCTACCGCCGCTGGT
GAAGGGATGGGCCATCCAGACCATCTGGGTCGAGCTCATCATGGGTGTTGTCTCCCTCCACTGATTCCATCTCCACGTCTCGTGCTCCATGATCGTGGAA
CACTTGCGTTTGTGGCCTGGGCATCTTCATAACTTGTTCGGCCAGGAAACGACCCATCGCAGCTTCGAAGTGTCGTTGCAAAGTGCCTGAGGAGGTGTCG
GGGGACACTGTAGCCGTAGTCCGGTCTATTGGCGAGGCAGGATTCGCGAGACGATTAGCTTGAACCCGATCCGACGATAATCCCACGAGCTTCTTGCTGG
ATCTGGCTCAATCCTGGCTGGATGGTATCAGATCGCGGGTATGGCGCCCTGGATTCCGAGTCTTCACACTCGAGGGCGCCTCCTGGCCCCGGATCTTTGC
CCGCGCTTCCAGCATTGACGCCCCAGAGGGGCCTAAGGTCATGCGTCGCAGCTCGAAAGACGTATTAGACCCATCCTCAGCCGCTAATTCGTAGTTAGAG
GATGCAGCTTGGCTGATCCTCGGCGACAACACTGGACCCAAAGTGTGCGACTCTTCTCCGGTGATGGACTTGACTCTGACGAAGAGGCCCTGCGTCGCCG
ATAGTATGAGATCCAAATCTAGCTCGACGATATCTTCCGTATCGAACGCACCAGCTACGATGCCCGAATCCGTAAGCAGACGTAATAGCTCCTTGACAGC
CACTAATTTGTTCGCCGTTTTCGCTGGTGCTCTCACCGGTTTCCTTGGATCTTCGATCTGTCGTGGATTCAGGATCCGCATGACAGGATCTTGATACAGA
AAATTGCGTAGAGCTTGGTGGCGATAAACGAACTCGAGCTCCTTATCGAACCAGCTTGACCTGGATCCAGCTTGGTCTTCTTCCGACTCTGGAGCTTGCA
TTTTCTTCCGCGTAGTCTTACTCGTAATGCTCTTCTTTCTCGTCTTTTCGACTAGCGAGCTTGGGTTTAGGTACGGTGTTGGCTTGACCGGTGAATCTGC
AAATGCATACCGTTTCGCCTCCACTTTCCCTTGTTTTGTTAGCGGATTTTGATTTGCGTTAAGATCCGCAGGGGTCCCCGAGGGAGCCTGGGGAGGATAG
AGAGCTTTCTCTTCTAGATCCGGATCCGGATCCACCTCTCTTTCGTCAACAGAGTTCCTCCCAGGACTCCATCGATCCGCGGATCTCGTTTTATTCAGCA
GCGTCTTCGACGATCCGACCTCCGATGACGCCTCTTCCCCTGACTCAATCTTCACTTGAGCATCTTCTTGGGACTCACGGTGAAATTCCGAGTCACCAAA
AGATCTGGGCACGCGCACCATTGTGGTGTAGCGGGATCAGCAAAATCTGCGAGATTGCTGGATCCAACTTACCAACTGCGCCCAGACACCGACTAACGGA
GGGGGTCCCCCGATGATCCGCGTTCTGCTGAACTTTCCTCACCTTGTGTACCCGTCGGTAGGGCGGGATCTTGCTCTCTCGGTAACTTCCGAAGAGCTCA
AGTGGTGAAGCTTGGGTGTCTTGGCGAGACGTGGGG