Description :
From Genome Similarity Track
Location :
Scaffold_20:33222- 36068
Sequence
2846 bases(100 bases per row)
CCAATACACTACAATGGCAGCGTGCCCCGATCGCATGGTGACTCGGAATCAAAAAATGAGAATCAGAGTGAAGAGGTTGAAATAAAGACAGGACCTGGGA
TAGAAGCGTCAGAGGCAGAGGGATCGCCGACGACGCGTGATATTAGAGGATCCCCAGATAATTGGAGTTTGAGAGACGCTTTGATGATTAGAAAATCAAA
GAGGAAGATCGATCGATCGATCTGGAAGAGAAAACTCTACCCCCTCCTGAGGCCCCTTCGGGGACCAGCGCGGATCGTGCCGCAAAGCACGATCTGCTGG
GTGGAAACCATTCTGATAAGACCAAACAGTTATCACCCAAGACCAATCATACGAAGTCAAAGGCGGAGAAAGTTAAGACAGCACGAGTGAAGAAAGAAGC
GACAAGATCGGATCAGCACGATCGCAGTTTGAAATCGATCAACCGACCTATCAAGTTCGTGGACGAAAATATGAAGATTTCCATCGGTTGGAGGAGGAAT
ACTACTGGAAGAAACTCAATAATCTTCCATCAAGTGAGCCAGTGCTCTGGATTCTGAAGCCCAAGCTGATTGGAGGAATCCAACGTCCGGTACCCCCACC
AGTAGCAGCGTCTGATATGCTGGAAGATATCAAAGGGATCATACAGCTGCTACATGATGCTGGTTTTGTCGCAGGGGTGTTAGACGCGAACTAAATGTTG
GAGTGTGATCAAGATCAGGTGACCCACGCGTATCGATCGCTATACGACAAGTTAATTCCCCTGACGGGTAAGTGTGATACTACCGATCGAGGGAGCACAG
CGATCGCGTACGCCCAGAGATGATACCTCACCGGATCGTCGCCGTACGGCTCAGCCGATTCTGGTGATTCGATCGGTATTCAGTGGATGTATCTAGGCCC
AAGGGGGGGGGGGCGGCACATCTGCGCGATCAACTTAAAACGATAGACAGCTGCACGTACTAAAGGAGAGACGAATTCGACTACGCAAGGACACCTGCAG
GCATACCTCGAAGAGGCCATGGAACGTTTTCAACTGGAACGAAGAGAGCAAGCGTATCAAGCGATCTATCCTAGCCAAAGGATCAAGACTCCAAGAGATC
AAGAAGCATACACCCCATATGTAGAATCGGTCCGATCGCATCGCAGTCGATCGGACATTTTCGATCCGGAAGACGTCGATCCTGATGACTCGGGTCAAGA
AAAGCGGAGACGTGCGATGGTGGCCACCGCAGAAAAGTNNNNNNNNNNCAGTCGATCGGACATTTCGATCCGGAAGACGTCGATCCTGATGACTCGGTCA
AGAAAAGCGAGACGTGCGATGGTGCCACGCAGAAAAGTTGCAGAATGGTGGTGGAATCCTCAACGTATTCGTGTGTCAGCAATGACAGAGACGAAGATAA
GGCCAGAAGCTGGATCAGCAAGGTCAAGTCGAAATTTCCGCGCGATCAGGCTCCAGACGAAGAAAAGCGTTTGGTGTTCGGCGATCTGTTGATATAGCCA
GCACAAAACTGGTACAACCAACTAAGTTGATCTACTCGGCACAAGTGGAAGCGATTGCTGGATTTTTTCATGATTCAGTATGGAGGACAAGGGGTGTCTG
TGGCTAGGCAATATTATCTTGCACGGAAGTGATTAGATGAAACCCCTCTGGAATAACTACATCGCCTTAATGTCACAGCAAAGCACGCCAAGATCGTGAT
TAAAGAAAAAAGATTGGCTACCTCGGCCACACGCCGCGAGCATGTGGAGCGCTTCTACGCTTGACGATCGCGATTCAGCAATACAGCTGACACTACTGCG
ATTGATGGATGTTGACGAGGTGGAGGAAACTCTACGTGCGTGCCAACGGATGGAGAATCGCCAGATAAAGTGCCGATGGGGTCAGACAAATTTCATCAGC
GAAAGACCGCCTCTTCGAATCTGATGTCGTCAAAAACAGCGCGGGCAGTGCGAGCGGTCCGCGAAATAGTCGAAAGCAGCGGATCAGAATCGGACTCAAC
TGGATCCAATGAAGATGTGGATAGTCGTCGAGTTTGCGTGACGACTATACAAGATCAAGAAAAATCGGACAAGGATCACCGCACCTGGCAGAAGAACAAT
GGTGACAGGGATGGACACGATCGTGGTGGATGATCGAAGGCGTGTACCCATTTATGGATCTACCAAACACGATGATCGAGGGTGCTGGAAGAGATTGACG
TGCCAGAAGTGTGATCGTAAAGGACATCCTTCTGACAAATGTTTCTTCGTGTGTGCAGCATGTGGACAGATACACGAGAGTGGCAAATGCCCCACGGAAG
AATTTTTCAATTGGATCCGAAAGTGGTGCGTGCCCACAAAGCATGCTGGAATGATTCCACCCAAGGTGGAGGAGACGTTAAACGAGGACGCTCGCCAGGT
TGGAATCTGGCGCCAGCCGAGCGTTCTAGGCTCTGTATTTATGCATTTGCTGAAGGACAACGGAAGGATCAAGAGATTAACGATCGGATCGATCGGATCA
CTGATATACATAATGATTTTACATTGGTCTCTTCAATATCAAGTGTGAAAAGAGTGAATGATTACGCCCGATCGCCTGTGAGGATGACGCTCGATCTCGC
ACCAGGGGAATCGCGCGGGTATTGGAAGTATCATACTCCATGAATTTGGTTCATGCAATCAAATACGACTGGTAGATCAACAACGAGAAAGCCACTATGC
TGTTCGAAACTGGCGCGGAAGTGTCGATCCTCGATAGTGACTTTGCTCGTAAGGTGTGATGTGTGATCGACGAAAAGTCAATCACAAGAGTGCGTCCTAA
TTGAAGAAATTCCTATAAGACGGTGTGGCGGAACGAAGAATCTAGA