Description :
From Genome Similarity Track
Location :
Scaffold_3:332085- 333385
Sequence
1300 bases(100 bases per row)
CGAGGATGACTTAGCCTTTTATTAAAACGGTGTATCATCCGCATTGGCGTGAACATTATTGTTGATCCCAAAGTCTGCGAACGGGAAGTTTTTGCTCCAG
TGCATAAAAGGTATTTTTGTTCGCAATACATCCTCCTCATTACGATTAACCCGCTTGGTCTGGACTTCGGTTTGTAGAGATTGCTACGAAGCAGCTCAAA
CATGACACCAACAACTTGACGTAAAAGGCGGACCCCTGTCATAATATATAGATTTGAGCATCCCATGTAGTCGATACACGTGATCCAAAACAAGCTGGCC
AACTCCTTGCCTAAAATATTGATGCTGAATGTGCTAAATGTACCAACTTGCTTGTTCTATCAACAAAGACAACGAGACCAGTCCTGATCTTATGTTCAGG
CAGTGTACTAAACATGAAGTTCGACCTGACCGACTTCCAACATTCAACTCGGATCGGCAATAGCTTCAGTTGCGCACTTCTAGAAGGTGCATAATTTATG
CGCTGACACTATTCCGATTATCGAATATAAGCGGCTACTCACCGATATAGCTGCGACCACCACCATTCATCTGAAATTCGTAAGAATGTCTTCTTAACGC
CCAGATGACTACTTAATATTGTTTATGAAGCCCATAGAGAATTCAATTTTGAAATTATGGTATGGAGGACATAGATTTTCAACGGATCACAAGATGATGA
GTGATGTCATTAATTCCATTACCGTTACTAGAGGCAGTTGAGCTTTGCCTTCATGTGCGACGAAAGAGATATCTGCCTTGCACCAAATCGATATAAAAGA
GAACGATTACGTTTGTCTCACATAGTTCCCCTTTATCTTAGAGGCCAGAGCTTTCGTCACATGATCAACCCGTCGTGCTGCCAGTGTAGACAACTCAACT
TGTGCTTCATCGCCTGCTACATTTTCGCGGTGTCGTGCCTCCAGGTCTGGTCTGCGCGATGTCACGTCAGCAAAGATGTTCTAATTCCTCGATGTATTTG
ACTCGAGAATTAAATAATCGAGAAGAATGTCAGTCATGTCGCACTCTTAGGTGATAGGTGCGGTGAGTTTATCGCGTTCCGCAGTGATGCTTAATCTGTG
TAAGCCACGCATGGTTTGGTGCCTAATACACGCACACGAAACTTCAAAAGAGCATACTTCAGTTTAAGTAACTTCTTGTCATACACGGGTAAATTCAGCT
CCATGGTTTACAGAGACGTGGACTAATACGGAATCAAACGTTCATGCCATAGTCATCTTTTTGCAGAAGCGAACTGCCGATGGTGAATTTACTCGTATCG