Description :
From Genome Similarity Track
Location :
Scaffold_162:33208- 38509
Transcript NameFunction/comments
Albla_Nc14087940chromodomainhelicaseDNAbinding protein putative

Sequence
5301 bases(100 bases per row)
AACGTCGCGCAACCGCTAAAAAGATAAAGTATGCAGAAGACGACTTATCAGACGGTGAAAAAGAAGAATTTGCCGAGAAACGTAAAAAGGCACGTCAGCT
CGAGTATCAAACCCGTCAGGTACCCACGCACCGATATCCCTATCGTGAAATTCACGTTTTCAACCTTCTAGGAAACGGCGTACCCGCTCTTAGATCAAAT
CGTTGGTCGTCGAATCAACAAACACAACGGACTCGTGGAGTATTTATGTAAATTTTCAGGTCGTTCCTACCTACATCTATGGTGGCTCTTATTTGAAGAA
GTCGAACTCTTCTTCCCGGAAGGTTACCAGAATGTGCACCGAATTCAAACGTTCGACCGCAAAATGCGACGGGAAGGGTATCAAGATACAGAGGATGTCG
ATGAGCTAGAACCCGGGAAAATTACCGTTGAGAAGATATTAAATCACAAAGTGGATCCCATGGATCACTTGGACCAAGCGATCGAAACACGTCGTGCACA
AGTGCCATTCCAACCGCAGTTCCCGCGAGTCACCGATGCGTTCCTCATCCAACACGCCGATATTGTCCATGCACGCATGTCAGGTCTGGTAAAAAAACTC
TCCAACGAACACGGAGGCGATCTCTTTCGTCAACCCGTCGACACCAAGTAAGTATAACATATCACAAGATATCATTTCTCACAATTCTCTCCATAGCCTC
GTCACCGACTACCTTCAAATCATTCACAATCCCATGGATCTCGGCACCATCGGCTCGCGTCTGGCACGTGAGAACTATTACATCGGTCCATCCGCCACCT
CCCTCTTCGCTTCCGACGTACGTCTCATTTTCGCCAATTGCATGCAATACAACGCCGAAAAATCAGATATTTGGATCGTTGCGTCCCACTTGCTAAAGAC
CTTTGAAAAGTGGATGAATGACTGGATACTTAGCCCAAGTGCGTGGCTCTCCTTTTTGCAAAATACCTCCACAAAATCCCAGCTGGAGCGCTTAGACAAG
CGGTATGAAGTCTGGGCACCCTGGGAAAGTGGATGCTTCATATGTCATAGTCGTGAAGATAGCGATAAACTCCTCCTCTGCGATCGATGTGACGGTGAGA
TTCACATGTTCTGTTCGTCTCCGGTGATCGCGAAATTGCCGCAAGGTGAATGGATTTGTTCTTTTTGTCGCATTCGGAAGGAAGCAGAAGCCAAATGGGA
ACGGAATCCTAAGAAAAACACCACTGAGCCGCCGATGATGCTCGTTAAGAAAATTGATTCCGAGCGAAAACACAATGCGCGGTCACCTACCGTGAAAATG
ACACGAAATTCCGATATGAAGGCGACTTTTTTTTTGGTCAAATGGCTTGGTCTTTCGATTCGATTTTCCACGTGGGAACGGCCCGAAGACATTGGAGATG
ACGAGGAAATCCAGCGATACTTCAAATTCGCTCGTGTTCCCACTACCAAAGAGATCGAATCGTCCACGTGTCAGCTTCCATGTTGCGCGAAACGGAATCA
AACACTTCATTCCCAGCGAAATTGCTGCGTGAAGGATCGATTCTGTACGCTCGGGCACGACCACCGAGGCGAATGCAGTCGGGAAATCCAGCGACATCAC
ATGACAGCCGCATACGGGACATCCATGTATCGCCGATATCGCATGACTGAGCAGATCAAAGCGCAATTGTTCGCACTACACTGCTTGTTGAACAATCACA
CGCCCAATTTGCATGTTCTCAAGCAGTGTGGCGCTCGAACGTACGCGTTTGCATGTCGTCGAGAGCTTTTGACGCCGATGATCCCGCATGACGAAGAAGA
GGATGAGGAGTACGCGGTGGAAGACTCTACTTCCTCTTCTTCCGAAGACGAGACTGAAGGAATCGATATGGAAGAGATGGAGCTCGTTGGCCCGATTGGG
GAGAAAGCCAATGTGGAGAGCGATATCCTTCCTAGTAAGAAGAAGACCGGTGTCCACGTGAGTGAGGTCGTCGGGTGTATGGTCGAACACATTGCGTTTG
GGTACGCATGCGATTTGGAAAAAGTCCAAAGACGCGTACGACGGAATTCCGCATTTCCTCCGGTGCTCACTGGCGATTTGGAAGCGTATACAGAGTATGG
AGTCACCTTGCGTCGATCTCCATTTGGTCTCGGAATGCGTCTTGGAGTCGCTGATAATGGAAGCACATCGGTCCTAGGCTTCCAGCAGCTTTCTAACGGG
ATGATGGGACCTGCACAAGCGGCGCAAGTGATCAGTATCGGAGACGTTTTGGTCGCTGTGAATGGCAATGCGGTCGCTGGAATGGGTTTCAAAGACATCA
TTCAGCTTATTGCTCGATCGATCGATTTCGTGACGCTTCATTTCCACACAAAAGCTCGACCTGCACTTGCATTTCCGCCATTCTGTCAAGCGCGTTTGGT
CGTCTGTGTGGACGATAGCGATACGCGGGAGGATGCGATTCCCAGCTCGAAATCCATTCCATACAGTTTCCAAGCATATCGTCCTGTGCTTCGGGTCGGT
GGAGACTGTGAAAACCGCATTCCTGATGCACAAAAGACAGCTTTCGTGACTCCTAACGGGCCGATGCAGCATCTCTACGCGGCGGTCGTGGACAACAGTA
TCGATCCACATGAGCATTTTGCGAGTTTTCTTCCAAGTAAACCGAAATCGACGACGGTGAAAGCGGATAAGGGCGATTTCATCCCGTATGAGCACTCGCC
GACGTACAAAGGCGGACGCACATTGCGATCGTATCAAGTGGAAGGTCTGAATTGGATCATTTCGTGCTGGAAAGCCCAGCGATCGTGCATCCTCGCAGAC
GAAATGGGCCTCGGGAAAACGATCCAAGTAGCCGCGGTGCTCGAACACTTTGTGACGGAAGAGAGTATCCGCGGGCCGTTCTTGATTGTGGTCCCATTGT
CCACGATTCAGCACTGGCGACGCGAGCTGCAGGGCTGGACAGATCTGAATGTGTGCGTGTACCACGATATTGGCGATCGACAGAATCGCGGGTTCAATTC
CAAAGATATGCGGGCCATGATCCGCATGCACGAATGGTATTATCCAGATCGAGGGAATAGCTCTATCTTCCGTTTCCACGCACTATTGACCACATTCGAG
ACCATCCTGGCAGACTTTGAAGAGTTTGAATCGATCCATTGGCGGCTTTTGATTGTGGACGAAGCACATCGACTCAAAAGCGCGGGCTCTCGCGTGCTCA
AGCAAATGCGTGTGCTCCATTGTGATCGAAAGCTTTTGCTCACTGGTACACCGCTGCAGAACAACATGCAGGAGCTCTGGGTTCTGATCAATTTCTTGGA
GCCTGTCAAGTTTGCCAGTTGGGAAGACTTTGAAGCTAAATTCGGACGATTGCAGTCGCATGAGCAGGTGGTCACACTCCAAAAACTCTTGGCGCCATAT
GTTCTCCGACGCGTGAAAGAAGATGTCGAGAAGAGCATCCCGCCCAAGGAGGAAACGATCATCGCTGTGGAGCTCACAACGCTCCAGAAACAGTATTATC
GCGCCATCTACGACAAGAACCAGAGCTTTTTGTATCGAGGGATTCAGAATGGGCTTCCGCGACTTGTGAATATCCAGCTGCAGCTTCGACAATGTTGTAA
TCATCCCTTCTTGATCAAAGGCGTTGAGGATCGTGAGCTTCAGGATCTTGGGCCGGAGCCTACAATGGATCGCATTATGGACAAGACGATTCAGTGTTCG
GGGAAATTCGTTTTGGTGTCGAAATTGCTTCCGAAACTCAAACGCGAAGGACGCAAAGTGCTCATTTTCAGCCAATTTCTCAAGCAATTGGATTTGTTGG
AGCGCTACTGTGAGTATCACGGCTTTGGGTACGAGCGATTGGATGGATCCACCAATGGAGCAGCTCGACAAGCGTCTATCGACCGCTTCTCTCGACCGAA
TGCCAAGTCGTTTGTCTTTTTGTTGAGCACGAAAGCCGGTGGTGTGGGCATCAATCTCATCGCTGCGGATACTGTGGTCATCTTTGACAGCGACTGGAAT
CCACAAAACGATCTTCAGGCCCAATCGCGTTGTCATCGCATCGGACAGAGCAAGACGGTGCAGATCTATCGTCTGGTGACTCGAAACACGTATGAGAGCG
AGATGTTTGAGCGTGCGTCGCAAAAGCTCGGGCTCGAGCACGCAGTGCTGGGCTCCGGCTCGTTCAACGATGGTGTCCAAGCCAACAAGCCCAGTGCCCA
GGAGCTGGTAGATCTGCTCAAGAAGGGCGCTTACGCCCTTTTAGAAGACGATCAAGCTTCCAAACAGTTTGCCGAGCGCGATATTGAGACGATTCTTCGC
GAAAATGCGCGTGTGTGCACTATGAGCGCAGATCATAGAAAGCAGAAATCGCTCGCTGGTATCGCTGTGGATCGGTCGTCTTTTGTGGCCGATGGGTCCA
CGGAATTGAGTGTGGACGATCCAAACTTTTGGGAGAAGGTTTTGCCCGGCGCCATGTCTGTGGAAATGTTGAGCATCCAGCTGGAGGATGGGAGCGCGTA
CGCGACCAGCGAGGCCAAGTCCAAGTTTATCGGGAAGCTGGGCATCGCGTTGGATGCTCTGGTGCTCGACAAGACGGGTGATCATCGCATGGGTTTGGAG
CGCGAGTACGACTTGGCGATTCAGGTGCTCCATCGAATCAGTACGAAACTGAGCAAGCATTTTACCCGGCACCTGGAGATCGTGGGGACGTACCTCTCGC
GTCTGGAGAAGTCGCGCGTTCGAACGTGTCGGACGCTGGCAACGCCCGAATCGCGTCGACAAGAGGATGTTGACGTCGATGTGAAGAAACGGAAGCGAAC
TATGAAGTCTTCCCGGCCGAAATCCACGCAGTTAATCTCAGAGACCCATGATCTGTGCACATTGTGCGGTGATGGAGGTCTGATTCTTCTCTGTGATGGT
CCGTGTCATCGCTCGTTCCATCTCGAGTGCATTGGGATGACGCACGAGCCTCAGGATGAGCATTGGTTATGCCCCGATTGTAACGCTGGAAAGCACATGT
GCTTATTGTGTAAAAAGGTTGGCGAAATGGGCGTGGAATTCGGGGTCTTGCAGTGTTCTATGGCGCGTTGTGGACGCTTTTACCATCGTGGATGTCTGGA
GGTCGATCGACATGTGGAATGGGTCGGTAAGAAGCGATTTCGATGCCCAAGCCATTTCTGCCATTCATGCAAAGAGCGGAAGCGTCCACGCCAATCGACC
ATCGTTAGCTGTCTGCATTGTGCCCGAGCCTTCCACGCGGATTGCATTCCTTCCAACGACAATGTCCTTCTGTCTGGAGGCCTCATGATCTGTTCGAAAC
A