Description :
From Genome Similarity Track
Location :
Scaffold_329:33205- 36535
Transcript NameFunction/comments
g9114.t1hypothetical protein

Sequence
3330 bases(100 bases per row)
CTCCAGAAGACGAAGAGGTGTGTTTCCATGAAGGTGGTGCCTTGTTTGCGGAAGACGTGGAAAGCCAGATGGCTATCCTACCCGAAGTGCCGACCACTAC
CGACGAAGTCACGATCGAAGACATTCAAGTGGGTGATCCGGAAACGAATACACCTGAGGAGATCGATCGACTTCGCCAGATCATCTGGCGGCGACGACAC
TTGCTGATCGGTAAAGGGAACGCCCTTCCACCCGCTGCGATTGGTGCGGTGTGCGACATCGACGTTGGAGGAGCCGCTCCCATCGCCCAACGCGTGCGGA
GGGTGGCCCCTCAATTCCGAGAGAAACTGTCTGATCTGATCAAGAGTTTGTTGTCCGCGAAAATGATTGAGCCATCAACCTCACCATGGGCATCCCCAAT
CGTGATCATCATCAAGAAGAATGGAGTCGACATCCGGCTGTGCATCGACTACCGTTTGGTGAATAGCCTGACCAGGTTGATGGTATATCCCATGCCGCTG
ATCAACGATCTCTTGGAGGACTTGGACAAAGTACTCTGATACTGCTCTTTGGATATGGCTAGTGGTCTCAATGACGGAACGTGCGCGAAAGATCTCCGCG
TTCGTTACGCCTTTCGGACTCTTCGAGTGGACGCGTATGCCTTTCGGGCTGAAGAACGCCCCACAAATCTACCAGAGGCTCATCGATAATGCTCTGTACG
GATACCTCCGGATAAGTCCTGATCGAGACCACACGGAACCAACTGACGTGTTCGAGAAAGGGGAGCCCGAGGCAAACCCGGGACCTTCGGTGCTGGGCAG
GCGATCGTACATCGACGATATCCTGATCACAGCTGACACCTGGGACTCGATCTGCAAGAAGGTCGAGGCACTGCTGGACGCTTGCGAGCGATGGAATCTG
TCGATCAGCGTGGTTAAGAGTTTCTGGGGACATCGGAAGGTAGAGTACTTGGGTCACCGGGTTCGGCCGAAGGTTTGGAAGCCAATCCGAAAGATCTGGA
ATCGCTGGAGAAGTTGCCGTTTCCGAAGACGTTGCGATCGATGCAGTCCTTCTTAGGGAGCCTGAATTATTACAGTCGCTTCATTGAAGACTTCGCCGTT
TACGCCGCAATCTTATACGAACTGCGAGAGGTGGACTTCTACGAGATGCACCACGGGAAGCATGAGGACCGAGCAACGGAGTCCGACGATCGGTGGACTA
GAGCGAGGACGGCGTTCGACCTACTGAAGGCCAAGCTTGCGACCACACCGATTTTGCGACACTTCGATTCCGATCGCCAGCCTGTGATCGTGGTCTACGC
CAACAAGTGGGCTATTTCAGCTGCGTTGGTTCAGGAACATGATGGCATGTATTGGCCTGTGATCTTCACCAGTCGTACGCTGAAGTCGAACGAATTGAAT
TACGGCATAGTGGACAAGGAAGTTTTGGCGCTCCTTCGGATTTTGGATGTGTGTTACACGCTCCTGACCAACCGATCGATCAAGGTGCTGTCGAGGTACT
CGACGCTCGCCTGGTTGCTGAATTCGTCGGGCTTCCAGGGACGATTGGGACGATGGGCAGCTCTGCTGTCCGAGTGGACCTTGGAAATCAGGAAGTGCTT
GAAAGGAGAGGACGAAATCCTGGGCGCGATCGCCGCCAGCATTACACCCCGAGCGGAAGTGGACGAGGCCTTGATCGCGATTGCACCGGTGAAAGAGCCC
AAACGAACGATCGTGATGGCCCCGCCGACGGTAGAGCTGGATGAAGAGCTGCTCGTCGTCAGTTTTGATGGGTCAGCACGCGTCAAGCGGAGCGCCGGAG
CGTATAGTGCAATTGTTTGGAAGCTCCCGGAGTGGTCGATCATATCTGCCGCGTCCGAATTCGCCGATGATCTGACTGTCAACGAAGCCGAATATCGCGG
ACTGCTGCTAGGCTTCAAGTTACTGTCCGATCAGAACAGAGGACGAGTTGTGATCTGTGGAGATTCCAACTTGATCATCCGACAGATGCGTGGTGAAATC
GATTGCAAGGCACCGGGTCTCCAGATACTACGTCAGAAAGCGATGGACCAAGTGAAAGCCTGGCCGAAGCACGAATTCCTTCATGTGAAGCGCGATTGGA
ATCAGAGCGCCGATCGGTTGGCAAGTGCGGCGCTGCAACGAGAAGCAGGCGTGATCATAACTGATGAGGGCGAAATTGGCGATCTCGTCACGATCAACCG
CCTGGGCGAGTTGCTCCACCCGAGTAATGACGACCCCGTCGTTCAAGTATCAGCAGTGACCCGATCAGCCCGACGGCACCGTCAAGTGCCGGCAGCTATG
CAAGAAGAGATCGTCCAACGCATGAGGAGTGAGAGGTTAGTACGAGCTCAGGATGAAGAGAAGTGGATCGTGGACCTGAAGTCGTACCTGCGGGGCGACG
CAGCAGCCTTGACTGCCCGAGATGCAAAAGCGTGCGCCAAGATCGCTGGAGATTACGAAGTGGGGGAAGACGACCTGCTGTTCTACTGTGTAAACACCGC
CCGATTAGACGAGGACCGAGATTCGATCGCGCGTCTGGTGGTACCTGCAACGTTGCACCAAGATTTCCTTCACCATTATCACGCCAGCCTTGAAGGAGGG
CACCAGGGAATCGGGAGGACGTACCAACGGATCAAAGCGCACTTTCACTGGCGGGGCCTGTTCAAGAGTGTCCAGCAGTTTGTGGGTGAATGCGTGGATT
GCGAGACAGGGAAGGGGCGCCCCGTGGTTCAAGGAGAATCACCTGGGAATGTACGGGCCACCTACCCCTTCCAAATCATCGCGATGGACCATATCCCATC
GCTGCCAAAATCGTTCAAGGGGAACACGGAGCTCCTCGTGTGGGTCGATCTGTTCTCAGGGTACGTGATCGCTAAGGCCGGCGCGTCTCGGACAGCACAG
ACCATCGCGGAGAACTACGAGGAATGCGTTTTCCGCCGCTTCGGAGCCAGCGAAGCGATCCGACATGATCGGGAGCCCGGTTTTATGTCTGATTTCTTCC
GCGCATTCAGCCGTATAGTGGGACAACGACAACGAGCCACCATGGCCTATCGACCACAGGCAAACGGTACCGCTGAGCGGATGGTGCAAACGCTTACTCG
CGCTTTGAAGATGTATGTCGCCGATGTGAATCAACAAGACTGGGACGAATACGCGGAACGCTTGACTTTCGCGATCAACACTGCTCACGATCGAGTACGA
GGAGAGACGCCGTTTTACCTTGTCCATGGCTGGGACTCACGATCGACCTTGGAAGCGTCGCTACCGTTAGGCAGCACGCGACGTCGCGATCGCGAGCCGC
GCAGATGGAGATATCGTATCCAGCAACAGT