Description :
From Genome Similarity Track
Location :
Scaffold_113:33205- 34669
Transcript NameFunction/comments
Albla_Nc14072820inositol3 putative

Sequence
1464 bases(100 bases per row)
CGAGTATGGAACATCATGGCATACATGCGTCACTGCATATTTCCACTGCAACGGTTGGAGATCGGGACAATAATCCAGCCCGCACATGCTTTTGTCGTAT
GAAGGATTGTAAAGATAGTCGTTATAGGTGCACTTGAAGAATGTTGTAAAGTTGATGATCATGGAGATGCCACCTGAATAAAATAGACAATTCACAACTA
GAAAACCCAAAATGATCTTTTTTCGAGGAACGGTGGCAAGTACGATATCAGCCCAATGGAAACACACTGATGTCATCATTGTCCACTTGATGCAAACCTC
AATTTGGGTCAACAGAAAGTAGAGATGTGTTGAGGAAGATTTCATTTGTACTTTGGAAGACTCAGAGATCCTAGCATGTCGTCTCATGAGAAAACATGAC
GTGTCACATACAAACAGCTTTTACCAGAGTGCATTAGCGATGATACCCAATGCGAACATTAGGATGATGGATATAGCGGTCACGTCATTAAAGAAGGTCT
GGATTGAAAATGAGATTCCATTCTAGAGCATCATCATCACCATTAGTGCATTGAGGTACAGAGGAGGAGAATGAAAGAATTGGGCAATGGCGTACCATTC
GGGTGATCAAAATGGCACCAGCCAGAACGATTGCATAAATTACGATGGACATGACACTGAATACACTGAGTCCGTGACGAAGCGCTATACAGAACGTTAG
TTGGAAATGACTTCCACATGATGCCAGCATGCAAGTTGAACGTACAAACACGTCGATGCATCAAGACCTGACTACAGTCTAAGCCTAACACACGATCTTG
ATCTCGAATTTCTATATATCCAAGTGCAGGACGTTGTCGACGTTGGTGCTGATGATTCATTGAAGCTTTTTCCTTCGAAACCACTTGAATACCGTGTAAT
TGTATCTGGAATGAGAATAAGTCGTAATCAGCAGCGTTTCTCCAAGTGAATGACGGAGTATATTGAGACTTTTTGAAGAATAGATGAGGAATGAAATTTG
TGATGCAAAAATACGTCGAATTGGTTGAATCAATTGACAAAGTCAGTTCATTCATGTTGTCCAGGCTTGCAAATGACGCCTTGAACTGGGAGAAAGGATT
CCTATCCCAGATAAATACAGCTGTCGCGGTCGAAGGATTCAGTATAGAAACCGAAGCATTCCTTCCCTTATAGAGGCACTGTGAGGGTTCCAGATCGACA
CATACTTCAAGTGGATCCGTGTGATTAAATTCATCCACAAGAATCGCTGTCGAGAGTGATACTGAAATGGTCATGCGATTTTGTCCGCTTTCGATCCACA
GCAAAGACGAATGAATGGGATTCATCCGGCGATACGGTATGGGCGTATATATCAATGAATCAATAGCTTCGGGTTCGATTTGCATTTCTTGAACATCCTC
TAATGTCTGAATGCGAGCCAGTGTGCCAGAATCAAGCGAGGTCTTTGTGAGACTGCGTGGAATG