Description :
From Genome Similarity Track
Location :
Scaffold_109:33204- 35075
Transcript NameFunction/comments
Phyag_g2180protein kinase, putative

Sequence
1871 bases(100 bases per row)
AATGTTTCACGACGTTGTCGTGCTGCGAAGAACGCATTACCAACCATTTTGATCCGAACGAGGTACGGATCTTCGCGGCGATTCATGTATTTTGGATCGG
CTCATCTCGGTGTTGGGTCCAAGAGGACGACCCTTGTTACGGCGGTGGTTGCTTCTTCGAAAAACATTTTCCAGCCACGTGCCTCGTTGGCAATCGCGCA
ACTGGCTGTAAAGTAAAGGGCGAAGCGCCGTCGGTCGACGATTGTCAAGTCAGGGAGAGTAAGACGTACCTCATGCACCTTACTGCCATCGCCACTTGCA
CGTTAAagcgttgctgttgctgctcactgCTCGCCAAACGAGAAGGCAAACAGTCTCGGCTCAACCTGCGTGTACTTCCTTCAGCGAAACGCTCGTCGAG
TTGGAACGAGCGCGGCACTGCGAAGGAAAGACCCACCACAGCGACTGCTCAGCTGCACTCAGTAGCTAGCTCCCTCACTCGTTCAGCATCTATCTATTCA
GCCGAGGCGACGAATGGCCCAGACGCGTGTGCCTTCGAGCGCCAAACAGCGCAAAGCGTCCATAAAATACTTTCTACCAAATATCCTAAGAAACCACATA
TCTAAAACCATCTTCAAAAATCATCACACGAGAAAAGGCGCATAGTTGTTCATAGTACGTTTCGCCGCTGCTGACTCGGCACCCGATCTCTTCACCCCAC
CTACTGTTCCTTCGCCTCTCATGGCCgagcggccgcagcagctcgcgttGGCCCGCGTGGCGGAGCTAGACCTGCCCTCGGACAGCACCGGCCGTcgcac
cagcgtcagcagcaccagcagcagcgacctCGAACGCCTccacgaagagctgcagctggagatcaagccccagcgtctgcagcgccagtaCACACTCACG
GTGCCTCCGTTCAGCGCTGGCGGAGCTTCCATCACACGCAGCGGACTGGTGGACGCACCCCCcgaggcgctggaagacGTTCTAACGCGATGGGAGAAGA
ATCAGGTCAAGTGGCGTCGGCGCGCGCCCAGCGACGTGGACAATGACGACAATCAGGACGGAGCAGAGGACACGGCGGCGATGCTCGAGGACGGCGGAGA
TCTGTTCGAGAACGTGCAACGGGCCGAGATGTTCGACGTCACTTTTGGAGAAGGATTTTTAGGCCTGGAGTTTGTGTATGACACCGTGCGGAACAGAGTG
GTGATCAAAAGCGTCCACGCAGACACGTGGTCCTCTGTGGTGATGAATATCCCGACCGGGGTGACGATTAAACGAGGCTTGGCGGTGGAAGCGGTGAATG
GACGGGATGTTGCAGCGATTTCGCCCGAAGATATTCTGGATAATTTGCAGTTTAGTAAAAGACCCATGACTGTCAAGTTCCGACGAGCAAGAAAGTCGGC
CGTGGTGTGTAAACTGTGCGAGACGAAAGTGCACGCCAACCACTTGGACAACCACATCAACTTTTGCGTGCTGTCGAAACgagtggagctggaggcggat
TGTATTAACAATTCACTGGTGAAACTCACGGCGGAGATTAATGTGACGCTGGCGGAACACGGCATGATGGCCATGTTTAACCAGGAAGAGATGCACATCT
ACCACGCACTGCGCGTTGTGGCCATCCAAGCGTCAACGTGTGACGTGACGAGTGTGGATGCCTTCGCCTTGTGTGCACGACTAGTGAAAATTATCGATAG
AATACGACAGCAGGAGGTGGATGCGACCAATTTGGACGGGGACAGCGGGACCAAATACTGCGTGAAGCTACGAAACTTGATTCATGCCAAGATGAGCAAA
ATGCGAGCGTCTCACAAggtgatgttgaagcagGCTCCGGTTGAAGTGGTACGGCCAGCGTTGAAACGCAC