Description :
From Genome Similarity Track
Location :
scaffold_1030:3320- 4843
Sequence
1523 bases(100 bases per row)
TAGTAACTGCCAGCGTCCGAAAACGCTTCTCGAGAAATTCCGCGATCGTCAAGAGCCTCCCGAAGCGTGGAAAACACAATTGTTTGTAAACGCCTTAGAT
ATCCCTATGCTGTGGCTGGGGATGTACGTGTTCGCGGATGAGGTTGATGACTCTGTGGCAAAACATGATCATGGAGATTCGAAAAAACCAAAAGACTGAC
TACGTTCCGAACTTGTTGAAGCCGGAGGAGGCAGAACAGAATCAGTTCCGCAGAAAACCGTCAGACTTCATCGTGTTCTGGGAAACTCAGTCATGGGGTC
AAATTTTTTAGGACCGCACCGAGCGTCTAACGCTTTGCATTCGTACGCAGCTATCTAAGATTTTTCGGAGAGTGTTGGATGAGTTGGTGGAGTTCATGTC
TGAGAACCGTCGTACTTTCTAGCGGATTAGTCACTGGATCTTCATCGACCAAGCCCTAAATTACTACTTTGGAAACCTTGCTAAGAATCAGAAGACCGAA
TGTGATCATGTGGAGAAGGCTTACACGCGATTAATCAATAAGTGGGTCAGCCAAGGGATGCGAGAGTCCCTCCTGGATGAACCAGGAGTGTGGACCTATC
CTTCCAAGTGCTAAGACTGGATTATCATGACCTCCTCTCACCGTGAACCTTCTTGAAAGGCGTAGACGCTGGAAGATCAGATGGAACACCTGGATCAGTG
CACGCCCGCTCTCGTGCAGTGGAATTCATGTCACTTGGACGCAGACCGCGTCAAGGATATTTGGGATCTAAGCCGCAACAAACTTCTTCCGGCGGAGCAC
CGCGGGAAGCACCTCAGCCCGCTGCTGAATTTCAATTGATCCGGAGAATCGTTTTCGACGCCCCAGGCTCGAGTCTCTCCTACTCGCTGCTGGATTTCAA
TTGATCCGGAGAATCGTTTCCGACGCCCCAGGCTCGAGTCTCTCCTACATGTTTGCATATCCTAGCACAGTTTTGACCCATAACTAATCCATTCCAACGT
TACATCTCCATGTCTTGTCACTCGTCTTTCATCATCACTATTGCATTCCAATTCGTAAATCATAATCCAGGAAATCGAAAACCACATTCAGGCACCTTCT
AATCCCGACATTTCAAAATTCACTTCGTCTTCATCAGGTTCAAAACAACTTCTGTCAATTTACAAACGACGATCTGGTTCATTCGGGTTGTACACATTCG
GGCAAGCTAAGTTCTAGGATGCTCATTTCCTGCTTGCATGGCCTGGAATTTTGCCTTGGCCCTTGGCCCTTTGTCGAACTCGTACAACAACGCTCCGTAG
CTTAGCCGTGACACGGAAACCCATTCAGGATCGGCATAACGATTCCACTTGACGAGATATTCTCTGGATCGCTTGGATTTGCGGTTCGTTTCACCCATCG
TATATCCTGAATGCTCTCCGCTTCGTATTCGTTATTCGCGTTATCAGGTTCCCAACTGTCCTCAGGTAATAGCGCTGCGTCCATCATCATCTTCGACTTC
AATCTCGAATATGGGCCTTTTTG