Description :
From Genome Similarity Track
Location :
Scaffold_1348:332- 3809
Sequence
3477 bases(100 bases per row)
GCCTTGAGTGTAGACTTAGCGTCCCAACCATGTACCAGATAGAAAGGGGTTTCTCGCCGAGTCGAGTCTCTTGAGTTGTTGATAGCGTGTACCATCTTCT
CGGCGATGTCATCCCAGTCGGCTTGAAGTGGGTCTTCCACGTAGACCCGTATAGTCTGAACCATTGTCTTGACTGACCTCTCTTGTTGACCGTTGGCTTG
TGGTCGGTAACTCAGCGTAGCTCTTGATCTCGACTGCATCATCTCGGAGAACTTTTGGAATACTTCGCTCATAAACCTTGGATATCGGTCGTGCCGTATC
AGGGACGGAGCCCCGAACTGCCTGAAGACGCATTCCTCAAATACCTTGGCCACTTCGAGTGCCCCGGTGTCATTCATAGCCTTAGCGATAACGAACCCCG
TGAGTGGTCCTGGAACAACAGCAGTGCAGTATTGCCCCGCTGTGTTCGAGGAAGGGGAATCACGAAATCCATTGACACGACTTGGAATGGATGGTCTGAC
ACCACATTTCCCGGCGAGTAACCTCTCAACTGTGGCTTGCTCTTACTGGTATTGCAGTCCTCTCAGGCCCTAACATGTTTCACCACGTCGGCGTAAAGAC
CAATCCAGTAGTAGTCGGCCTTGCCTCGGTGATAAGTTCTGACGATGCCCTGATGCCCTCCTTCGATCGAGTTGTGACAGTTATGAAGTATTTCGTCGAC
CATAGTTGACGGAATCACCAATCTCAATGAGAGGTTCGGTTCGCCGAGTTCGCCCAGTCGGCGAGCTTCATCTCGGCGGTATAACAGGCCGTCTTCGCTG
AGTACAAAGACTTCTGCGACTTTGCCGGCATTCTGAGCTCGACGGTGTGTAAGGTCCTCAAATTCGCCTCTCAGGTACGCTTTCAGATTGGCCCACCTAA
GTTCTTCATCTTGTGCCTTCGCGATTCGTCGTCTCCGCTCAGTCTGTACCGTCACTGGATCAATGTCGTTGGCATTCTGAGCTATCTGGGCCGACTCCAT
CTGCGACCTTGTTTCTACATTCGGGGTCGTGTGGTTAGTCCGTCGAGTCGACGCCCTGCTGACTTGTTCGAATTCATCTCCACTGCTTTCAAACGCCGAT
TCTCCAGGATTTGTTGATATGGCTTCGTGATCCAGACTTCTTCCTCTTGCTCTAGCCGAGTCTTCATCCAGCTCGTCCTCAAAGTGAACGCGGCGTACTC
AGCTACGAGTGACTGCCGTGACAATCGGGGTTTCCGCTGGGTTGTCTGTGGCGTACAGTTCTTCGGCTACTCGGTTAATCATTCTCAGTTCTGCTTTCCT
ATCCGTCCCGAGAATTACTCGTCCAGCTTTAGCTTTAAGTGCTTCTGTAGCGAGAGAATCAGCCGCTGCGTTACAGTGTCGCGCTATGTGTCGATACCGG
ACCGAGTTGATTTGCTTCGTGAGACCCTTGTGTCGAGCTAGCTCCACTTGCAATGTTTCCTTCATGCATGCTATCACCCCCATGGATTGCTGGATTGCAA
GCCGGGAGCCACCCACGATAATCAGATCGGTTATCCCTCGGTCAATCGCCGCCAAGACTCCATTGTCATGCCGGTGTACTCGGCGATGTTGACTGTGGTG
GACGACAGGTACGCACTCGCAGCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGGGATGATAGCCGAGCTCATTCTTCTTTA
GTACGCGTCCGCAGAAGCGAACTGGGTGCAGCTTGTGGTCGTGCGGTTGCATCAATGTACTGCTCAGTGCCCAGTCATTGGCGTACAACATTATGTGGAC
TTCTTTCGCCGAGTCGAAATGGCGCAGAATTAGAGCTTCTGCTACCCGTCTTTTGAGCTCGGCGAATGACGCTTTAGCTGACGCCAAGTCACCCCCAGGA
ATAAAGTCCGTATCCTTTAGCTGATAGAGTACCGCTCCATAAACAGCCAAGTTCTGGATGAATCGGCCGTAATAGCTAAGGGCACCGAGGAAAGCTTGCA
TCCCCTTCTTTGATTCGGGAAGGCGATCGCGGCTATCTTCTTCGCATCAGCGCGTATGCCACTTGGCGTAATCTCGTGCGATAGGAAATCAACCTTGGGT
TGGATAAAGATACTCTTAGTAAAGCTGATGCTAATTCGACATTCTGTGAATCGGGCTAGTAATCGGTCGAGTGTCTCCAAGCAGGCGTCGAACGTCTCCC
CCCCAAAACAGATATCATCGACAAACGACCTCCGCTTGAACACCGGAATCAAGGAAGACTGGTCTGGTTCTCCATTGGCAAACATGTCGCCGTCCGGTCC
GTTTACCAAGTCTTGGACCGGATCGCAGTCAGCTTGTGATTTGTGGTCAGCTTCAAACTTCGTCAGCTGACTCTCCGTTGAATTTCTGACTCCGCCGAGC
TCAACTCGCCGAGTTCCTGACTCGGCTTCAGCAACAGCCATTCGTTCGGCAAACAACTGCCATCCTCCCTTTGGTTGAACGTAACCCCATAGAGCGTTGT
CGATCAGTCGTTGGTAAATCATAGGCGCATTTTTTAATCCAAATGGCATTCGTAACCATTCAAAGTGTCCAAGTGCACATACGAACGCTGAGATCTGCCG
AGCTCGGCGTGTCATCAAGACTGCCCGGAATCCACTCGCAGCATCGAGCGAGCAAAACCACAAGTAACTTTCCAATTCGGTAAGCAGGTCATCAACCAGT
GGCATAGCGTATTCCATCCGCGTCGTAACCGCATTAACCAGTTTATAGTCAATGCGTAGCCGAATATCCACACCATTTTTCTTTAGCACTATCACCACTG
GCGAGGCCCAAGGGCTGTCCGAGAATGATATCAACCCAGCTCGAAGCAGCCCTTCAACAACTCGTAAAGTTTGCTCAAGTGGCGGAGAGGTATCCGCCGA
GCTCTCTGCTTAATGGGTGCGTGTCCTTGAACGTCGATGTCGCACAATGCTCCGTACGCTGGAGGCGGCAGGGCATT