Description :
From Genome Similarity Track
Location :
Scaffold_2283:332- 2773
Sequence
2441 bases(100 bases per row)
CGGGTCCTCTTTTGTTCGGCTACCCATCTACGTGCTACCCCCACTAAGGTTGGGATTCCCGTGCCAATCAGAATGAAGAGATTTTCGTCACAAACTCTCA
TTTTCAAGTCGAAAACCATTGACTCGGCCGCGCGAGCGCGGCGGAGGCTCACTTTACAGTTAGAGCCTCGAGCAGCAACCTGTGCGCTCTTCGTCAAGGT
CTCCACTTCGACCGTTAACATGCCTCGTGGCACTGCTAAGAGCGGTGCTAAGACACGCTCCAAGGCTGCAGCCGGTAAGGCGCAGGCCAAGAGCACTAAG
CCTCACGGCAAAGGCTCTGCACTTAAGGAGGCTACTCAGGTGGCCTCCGAGGCTATCGGATCCTCGGGTGACGCGGCTGCGGACAAGCGCGCAAGCAGGC
GCCGCAGTCCGTCGCCCTCGTCTTCAGACAATCGTCCGAACCCTCGGTTCGTAGAACGTGAGTTCAACTCGGGCAGTGAGGACGATGCCGAGTCCGAGAG
CACTCATGATGCTCCTGCGGGCTCTGTGGGAGGGCACAGCCCAGTGCCCAGTGAGCACAAAGAAGACAGCGTGCAGTCGTCCGCTAGTGATCACGGTGAT
CACAGTCCCAGGACCTCTGTGCGCTCTGAGAGTCCGGCCGTTAAGGGCTAAGGGCACTCCCAAAGCCGGTGGCGATGAGGAAGGGAGTCCTCGCAAACGT
CTCTCGCTTGCCGAGGGTCTTGCGCGCGCTAAGGCCTCTAAAGCCGAAGGCGCCAAGCCCTCAAAGAAGCGTACCGCCTCTAAGTCTCCACTCCGCGAGG
AGAAGGAGACTCGACGCTCCTATCAGAGTCTCTTCGGCTCCTCGGATGAAGAGGAGGAGAAAGGAGGAAGAAGAGGAGGAGGAGGGTGCCCATTGTTGAG
CCCCGGGAGGTCTCGAATGACCTCGACCAGCAGCAGGAGGATTTCCAAGCTGCCCAGCGTGTGCGTGGGGGTTCGGTGGCGGCACCCGTCAGCCAGGGAG
CTGCCATCAACTCAAGAGGGTATTGGCCTCCCGAGGAGAGCTCTGGGGCTGACCTCTTCTTAGAGCTTCTCGTCGCTCCTCGTGGCCTTGTGGGCGGCCA
CACTTCTAGGGGCATCTATGAACGAGCCCTTGTTCAGAAAGAACAGTTGTTCGTCGACAACGTGGAGGCTGCTCGGTGTGTGCTTCTCGCGCCACACCGC
ATTCCCCTTAAGGACTTCACGACTTGTCGTAAGAAGCCCGAGACCCGGGGTGGTCTCTATCCTGTTTGGGGATACCCCTGGGTTATGCCCGAGAACTGTC
CCACATGGAGTTCTTGTGAGGACATGTTCTGGGCGTGGGTGGAGACTCTCAAGTACTCGCCCACGGAGTTATGGGAACTCCATGAAGATCAGCAGCTGTC
CCACATCCTGGACCAGCGTGATCTTCGTGTGAGGTTTGCCCACTTGATCAGCAAGCGTATGCTGCCAAGGGACATCCTGAAGCGCGCGGCTTCTAGCGCT
CACGATGAGCGCGGGTACGGTATGTATTCATCATCCGTACCCCGTTCGGGCAAGAAGCCCCGGACTACTTATGAAGCTGCCGCCGCTTCTGTTCCCAGAT
TGCGACAGCCTTCGGGCAGTCAATCAGGAGCCGTTCAATCGGCTCCCACGAGTTCTCGGAGTGGGCATAACCCCTCCACTTCACGAGGAGCTATCGCTTC
CCGCGACACCGTTGCTCCTGGAGGATCCGCTCCACGTGGAAGTGGACTTCTCCATTCCGGTCAAGCAGGGGCGGAGGTGCCCTCATACGAGTACGAGTAC
TCGGCGCCTCCCGAGAGCCACTCTCGTTCGAGTGCTCCGACTGCGGGTCCGACACGGGACCCTGAGGTTGACCGCCTCCGTCAACGTCTCCTCGTGCTTG
AGATTGCACTTGGCCTTGGGACTGGCGGTAATGCTGCCGCCCAGGCCGGGAATCAGGGCGAGCTCGCTCGTCTTGCGGGTCGCCTGGACCTGGTGGAGCG
AGAGGTCGCGAGCCTGCACCTGCGGGTGGACCGCCGGGCCTCTTCGTCCGATCTGGACGAGGCCTTTCGCATGATCCGACGGATCGAGGCTTTGTTGCCA
CGTCCGGAGCCGCCTGCGGCACACTCCCAGACGTACGCGTATGGTGCGTACCCGGCGTACTCAGCGTACTCGGCGTATGGCGCCGGGGTCCGTTCGTATG
GAGCCTCTCCGGCGTACGGTCTTGACCGCAGCCTTGCCGTCCCGACCGAGGCTTGGGTGCCTGCTCCGACGACCTCGTCAACGACTGTGACTGGCCCTCG
CTTCGAGGAGCTGGGTCAAGGGGGGTCTGCGAGTCAGCAACCCCCTGCGGGTCAAAGTACCGCTTAAGAGGTCCGACATAGAACGTCGGGTGCGTCGTCA
TTGACTTTGGAAGGTCGATGGTGTACGACGCACCATGTCTC