Description :
From Genome Similarity Track
Location :
Scaffold_1224:332- 1398
Sequence
1066 bases(100 bases per row)
GTTGATGCTGCTTGGGGGGGTGTCAGATTTGCAGCAACATGGCTGTGCAGGGCAGCTCCATGATGTTGTTAGCCACAAGCCCCAGTATCTAGTGCACTGT
TCGAGAACCAATCTGATAAGGTGCTACGTAGGGTCGCCAGATAACGCGTATTGCATTCGGATGTGTTCTCAAACCTATTCGACAGAGATAATAGCTTCTT
CATGCTGTGTAGGAGATGTAGCATAATAACAAGAATTATACTGTTTAAAAAGCTTTGATGATCGTTATGTGCGAGCTAGGAATGTTGGTGTCAAATATTA
ATCAGCCCGTCATCGGTATTGTACTGAACATCGCTCAACCACCGCTTAGAAAGTACATCTCATATGTATTCTGGGCATGCTGCTGCTGATTCCCGTAACT
AGTCGATTTTTCACATAGCGCACGCGACGGTTACGAATACTGATTGACACTGTCACGCTGTCAGTACAGTTGGCCCGCATAACGCACCGAAGTAAACCTT
TCTGACCAAAGATGCTTTTTTCGAATGCGCGAGACCTATCAAATCACCGCCGCAACCGTGCTGTGCATTCTCGGCCTTTCACACTCATGAGTCAAACTCA
TAGTGCAAAGATGTCCTTACGTTTACATGGGCTGCCAGGGGAACAGCAGTGCTCAAGTTAAGCGTAGGGCTAAGCTTGTTCCTGCAGCTACTGTATGCTC
ACGTGTAGCCACTAGACTTAGTTAATCACTGTTGGTACTTTACATACAATTTGACGAACCTGAAGCATGGCTGCTATCACGACCGAAGTCAATCTAACAA
GCTCTAAAGGATGGAATTTGAGTTTATTTGACTCAAATGAGGACACATGCTTTATGACATACGGATTTCGAAATGGATGGCGTCAAAATGAAAGAAAGAC
ATGCATTCATTGCCAACGCAATCAGGACGCTGCCTACTCTCGTATTGCATTTTACAGACCACACGACCCCGACTGTAGAAAGATACCTGCAATAGAATAA
ATGTATACGGCATTGTAATGGCGTCGGGAGCGACATATTTCATTCATCATTTGACTTCGCTCGTAC