Description :
From Genome Similarity Track
Location :
scaffold_48:331970- 348021
Transcript NameFunction/comments
g7508.t1 hypothetical protein PHYSODRAFT_259509
g7509.t1hypothetical protein
g7510.t1 amino-acid acetyltransferase, putative

Sequence
16051 bases(100 bases per row)
TTACAATAGGATTGCTATTGGGGGGTTCGATTATCCCCACCATCAGCTCGTAGATACACGTTAGTCGGCATGCAGCGGCGCTGGACGACGCCGAGCTGGG
GTTATGCCGTCGTGAAGCCCGTGAGGTCCGTGTCCAGCGTCGCGTACAGCATACTCTTCAACTCCTTCTTGCTGTGGTACAGCGGCAGATCCAGACGATT
GAAGCATGCGTGACTCGAGATGTACTGCGTCGAGCGGTAGGGCACACCCTTGAGGTTGAACGGGCACAGGCGACCATCGTAGCTGGTAAGACCCCGGAAA
CCCGACAGAGGGACACAGGCAGATCCTGTCGCGAACAGCAGCAGGCGTCGACGGTACTCGTTCGGCATTTGGCGAACAATCTCCCAGAACCAGCGAGTTA
CGCTGACGCCCTCAAGGTTAGGAGACAATACGGTGTGAGTCTCCCAGTCCGTTACGTCCACTTCGGGGGATCCACACAGCAAGTAGTCGAATTCTTCTGG
GTCAAAAATCAAAAGCATCTCGCGAGGAATAACCTCGTACAGACCCTTCAGGAATGCATGCAGTTGGTCCGCCACACTCTCGAAGAGCACGTAGCGGAAA
CGCCGGTCCAGGTACTCGCGCTTGTTGGCATCCGTGACAGCAATATCCCGTCCATTGGGGATAAGATCCACCACGATTTTCTCGGTTTCGTTTACCTGCT
CGGTTAGACTAAAGTCAAGTCCGAGGTCGTCCACGCCGTCGTTGTCCATCAGCCATCGGAGACTGCGGTACGCCTCTGGGTCGAGATACTCCATGTCGGC
AAACGTCACTGGCATACCCAAGATCACCTTCAGCAACGGCAGTGCGAGATGAAAGCCCCAGATGCCGCCTTCCAGCAGAGCCCGACCAATCAGTCGACCT
GTGGCAAAATAGTAAGCTAGGTGGTCCTCGCCTACCTCAGACCGGGATTGCGGATTGAGAAAGTAGCTCTGGTCGGCCTTGTTGGTGCATGTAAAGAGTC
GAAGCGTCGGCGAAGCCAGCAGCTCGTTCACCAGCATAAACCATTCGCGGTGCACCCCGCCAGCATCCACGCCGCTTTCATCCAGGAAATTGATGCGCAT
GAAGGAGCGCAAGTTCTTCGGCTGAATGCAGTACATGTGGTCCATCGACTCTTCCAGCATGTACTCGCGGTGGACAGACAACTTCAAAAACTCCACTTCT
GCAGGCACGATCAGCGAGGCCGTGCTGACCACAAAGTGCGCGTACTTTGAAGGAAAGTCGCTAGTCGCCAAAGAAACAACCTCCTTGCGTCGTTCAGCCC
CAGCATCGGCGAGCGTCGACTTCCCGGTCGCGAAGTCAGCCGGGTCCGAGACGCTCGCCTCCACCAGCTCCAGCTCCACGTCCGTCGGCAGCATGGGCTT
GTCGTCTGCATTTTCCTTCTCACTCTGCGGTTGCTCCACAGCCAGACTCGGCACTGGCTCCGTCTCCGTCATGGTTTCCTGTTCCTCCTGCTCTTTAGTC
CTCTCCTGCTCTTGCTCTTCGGCCAGTTCCTGCTGTTCCACTTCCTCCGGGAGCTTGAAACTCAATGTATACCCCGGCAAGAGTGTGTCCACGTCGCTGT
TCGCAGGCACGTGGCCTCCGCCTCCACTGCGGTACCAGAAGAGATTCCCTTCCACGTCCAATTTCCTCGTCCACTCTCGTCGGCTGCGCGCACGCCGCTG
CTGGCGACTCAGCGACGACATTTTCCTCGGACGTGGCGACAGCAGGTGGGTCGCGCTCATGGCCATGTTGATGGCTCCTCCTCTGCTGCTGCAAGTGTCC
TCCGGCTTGAGCTGCTCGTCGTCGCTCTCGTCGTCGGCCGTGGCGAAGGACAGCGACGGCAGCTTGTCGCCGCACAGCACGCAGTACTCGAAGCGCTTGA
AGTTCTCGAACGCGCAGCTGGCGCACACGCTGTAGCCCGCCTCGGCTTCTCGCGTGGCAGCGTCGATTCGGTGGTCGACCGACTCGCCCGACAGCAGCGG
CACCTCCATGTCCAGCAGGTGGCGGTTGCGACGACACGCCATGAGCCACACCACGAAGAAGATGATGCACAGCAGCAGCATGCCCACGCCCTGGTACAGC
ATCGACGCCTCCGTGGACCGCTCGTTGTCCATCGCGGCGAGTCTTCAAGTGCTGCGGTTCAAGTCAGTCACACGCAGAATGACCTTCGCTGAGGGATCCG
TATTTTTCACTTGGTTTCAGTATTGCTAAGTCGCGTTTATGCACACTAGATTACGGCGACGAATCCCCTCGAAATAGTGACAATCCACTCACAGCGACAT
GTTGACGGGGCTTGCATGTTCCGTCACCGGTTTCCCCTAACGGCAATGTACCAACGTTGGTGCGCACCCGATGGCTCTGCTTCAAACCATGCGGTCAAGT
CACTGGCTGCCGTTGTTCCTGCCAGCACTTGTGACGTCTGGATCGGCGATCCGACGCGTGCAATCGGTCATTGGCCTCTTGGTCAATGGTCGGACATCTG
CAGGCGACCTGCACTTGCATTCCGTGAGGAAAACAGGCCGTTGTGACAATGCATCTCCACTGTCCTCCACGATGACGGCAAGACACGCCGCTCATAATTT
GCAGTCGATATTTAGGTCTTTGGGTACTCCACGCTGCCGACTTCCTACGCCGTCGTGAACCCGTACGTCTCGGTGTTGAGCGTAGCGTGTAGCACCTCCT
TGAGCTCCGCTCGCGATGATGCCAACGGCACGTCCAACCGGTTGAAGCACGCGTGGCTTCGAATGTAAGGGGAGTGCACGCCCTTCAACGTGAACGGGCA
GATCTGACCGTCGTGGCTCGTCAGGTGTCGGAAGCCACCGATCGGGACTCGCGAGCACCCCGTTGCAAACTGCAGCAGGCGACGCCGGCACTCCAGGTTC
ATGTCCCGCACCAGCTCCCAGAACCACCGAAGCACTCGCGTCCCCGTCAAGTTCTTGGAGCACCTCGTGTGTGCCTCCCAGTCCGTAACGTCGATGGAGT
CGCAACCGCATAGCACATAGTCGAACTCTTCCACGTCAAAGAGCATGAGGATCTGCCGCGGAATCACTTGGTACAAGCCTTTCAAAAACACGTACAGCTG
GCTTGAAACGCTTTCTAGAAAATGGTAGTGGAGCCACCATTCTGCGAATTCGTGCTTGTTTTCATCGGTCACCGGGATCTCGCCACCGTTTGACACCAAA
TCCACCGTCACCATGGTTCCACTTGCATCTCTGCGCGTTGTCGTGAAATCTAGTCCGAGCGTCGCGGCACCATCGTGTTCCAACATCCACAGAAGACTTT
TGTACGTCACCGGATCCAAATCCCCGTAGTCGCGAAAAGTGAACGGAATACCGAGAATGAGCTTCAATAGCGCTGGTGCAAAGTGGAAGCCCACCACTTC
GCCCTCTAATAGCGCACGGCCAACAAGACGTCCAACTGCGAAAAAGTACGCTAGATGCTCCTCACCGATCGCCTGCCTCGAATTTACGTTGAAGAAATAC
GTCTGGGCCGCATGGTTCGTGCAGGTGAAAACCCCCAGAGACGGGTCAATAACCAGCTCCGTCACGAGCGCGAACCATTCGCGGTGCACACCCCCAGCAT
CTACAGCAGTCTCTGCAGCAAAATCAATTCGCACCACCGAATGGGTATCATTGTCATCCATACAGCACAAGTACTCCATGGACTCCTCGACAACGTGTTC
ACGACGTAGAAACAGCTTCAGCACTTCCAGTTGAGGTGGGACAATCAGCGTAGAAGTACAGGCCACAAAATGTGCGAACTTGGTTGGGAAGTCTTCTCTT
GACAAATTGAGCAGGCCCTTGACGTCGACATTTCTGGACGAAGGTGGCCCCGTCGCGAATGCTAGTGCGTCGGCTTCGTCGGCAGCCACAGTCTGTATTT
TCATCAGCTTCGTTTCGTGTTCCAGCTTCCTAGTTACTGAACCAGGCTCTCCGTCCGGTATCACGTCCACCTCAGTCTCCATCTCTCTGCCATCTTTGCC
ACCCCCTTCCTTGAACACAGCAACATATCCAGGATACTGGGAGCAGTTTTGAGACGCCTCCGCATTCCGATACCAACAGGCCTTTCCGGTGCAGTCAAGC
TTGCGTTGCCATTCTGTTCGACGCCTAGCACACATCACCATATAATAAAATAAGAAGTCAGCCTGCGGATCAAAGCATACACAACAAAAGACCAACCAAC
AACGCACTTTGCCCGCACTTGTCGAGCGGTAAGAGGGCTTCTTGCCCGAGATCTCTCTGTCGGTGACAGCTTGAGCTTCTCCCCGCAAAGCACGCAGAAC
CTGAACCTCTGTGTGTTTGCGAATGCACACACTATGCATCGTACTGCCTCCTCCTCTGCGTCCCTGCAAGCAACCGCCACCCCGTCTCAGTCAGCAGCGT
GTCCTCAACACCCCAACCGACCTCCGTCAGCCCCCCATATCCTACGTACAACGTTGCAACATCAATGCGATGCTCTCCGGTCGCATCATCTCTGCAGAAG
CCACATTATCACAGCGTCAACACCTCAAAATATAAAAAATAAAAAAACAACAACAACGAGGAATCCGCCGCCTACCTGGCGATCAATGCCTGCTGCAACT
CGCTGTAGCTGCGCTCGCGGTACTTGCGCTGCAGTTTGCGGAAGATGTAGGCGACGATAAGGTATAGTGCCACCTGGGAGGCCACGATGAGCACCACGAT
CACGTCCGCCATCTTCGGAGCTTTTCGCCTTCTTCAAATTGAGCACAATCATTGATGTCGATGATAGTCATTAATTCGAGGGGAACTCAACATCGATAGA
GTCACTGAAGTGGTGCATACAACTATATCATGAGCGGCGCACTGAACGACAAGAGCGCGCTGGTGCTGGAGCTGGGGGCACGTTACGCGCGATGCGGCAT
CTCTGGGGAGCGCGCGCCTCGCTGTATCGTGCGCTGGCAGGTGCGTTGTCACCGTATTGCGCGCATCGGGTTCGAGGTTGCTCAAGGAGTATGTGGTCAG
GTGGGGGACATGCTGCAGAAGCCCTTGACCGCCGCGGACTGGCGCCAGTATCTGTATCCGGAGCTGCACACGCTGTGCTTCGAGTGAGTGGTTTGGATCT
GCATCGACTGCGTGGGTTGCGTAGCTAACAGGCTGCTGTACTGTCAGCTTGCTGTTGGTGAATCCGACGCGTCGCCGATTCGTCGTGTGTGAAGATCTGC
TGCTGCCGCGGGTATTCCGGGAGACGCTCTTGAGCATTTTATTTGATGTTCTCAAGGTGGTTATTGGATGAGAATAGAGAGTTGTGGTTTGGGGGGCTGA
ACAGGAGGGTATTGTGGTTGTGCCAGGCTTCTGCGGTGTCGTTGGTGCCGTCCATGATGGCGGTGTTGTACGGTACAGCAAACCACACAGCTTTGGTGGT
AGACTGCGGCTGGGCAGAGACGCGACTGCTGCCTGTGTTCAAGGGTATACCGCTCCCTTATCTTTACGAGAGTAAGTTTGGTTACTAGAAGCTGTGGAAG
AATGTGGAAGTGACGCGACGTGGTGTTGCTGTGTTGAAGCTGTGCCTGCTGGAAGCCGGAACTGCTGTGAGTTGATTCAGCGAGAGCTGAATACGTCTCG
CGACCAGCCGATGGATAGCTTGAAGACCGTTGTCACGCCTGTGACTGAAGCCATTGCAGAAGGCATTCTTGAACGGGCGTGCTTCGCACAGCAAAAGGTA
CACCAGGAGAGACTTCATATTGCCGAAGTTATATATCGCGGAGCTCATGTTTCTGCTGTTATGTGCTTCGTGGATCAGAATCCGTTGCCAAATGTGGTTG
ACGCAGAGTTTCAGACCCACGACAATGATGTGCTGCAGGTCGGTCGCAGTAGTAAAGGCTTCATATTTTCACTCGTTGCAGATTCTGACGGTGTCTCACT
TGGACCCTACTTGCGTAATAGGTTCCTGGAAGCTTGCGCACTGGAGCCGTAGAGCAGCTACTGATTGGTATGCATTCGTGGTATCGGATGGCCTGCTGCA
ATTCCTAACACATCGAATTCACCTCGCAATTCGATTGTTCAGGTGACGAAAGCACGGATGGGATTTCAATTGTCGACGGCATCATCCAAGTCTTGAAGAA
GGCCCCGCTCGACGTGAGAGCAGCAATGCTGGAGAACCTGCTGCTTGTCGGAGGAACCGCTATGATTCCTGGTAAAATTACCGTTCGGGTAAAATGTTGG
TATATTCCTTTGCAGCCATGCTAACCTGTCTATGCTTCAGGCTTGGCGCAGCGTGTCATGGATGAAGTACGCGAGGCTCTACATCATGATAATGAGTTTG
CCTCGGCTTCGGCTGCTGTTGACCGAGCGCAGCTCGTTCAGACATACTTCCCGCGGAACATGCTTGCCTGGGTTGGCGGATCAGTATATGCTGCCACGGA
GAGCGCTCGGCTCTCGACTATTTCATCGCAAGAATACAGCAGCTCCAACGGCACCAGTATCCCTGACTGGCTCACTGTCGCTGAAGAGGGATTCTAAGTC
GAAAGTGACTTTTGCAGCGAGTATGTGCCAGTGACGGAGTACGTGCGAGGATTTGAATGGTTAGTGTATTTCCTATTGCCGAAATTGTTGAGCTATGAAG
TGATTAACAAACCTTCGTCAGCATGTATGGCACCATGGCTTCGTAAGCGAGACGGCTTTAATGTAGCATTTTAGCCGTCCGACTTACTTACTCGTTCGCA
TTCCGAGTGGCTTGCCAGTGTCGTCCCATGGTGCCTTCATGCCAAGATCAGGCATGTTTTTGAGATTGGTAGTCGCGGCTCCACTAGGCCGCTTCAACGG
AGCGACGTGATGTGGCAGTGCTGACTTGCGTGGTTGCATCTCTCTCGCCACCTTTGCGTCTGCGTCTGCCGACAATTTCACACCTTCCTCGCGTCGGTGT
TCCTCCTTGGAATCGGCTCGGAGTTGACTCTTGGTGCGTGATGTGATACAGTCGACTGCTGCGGCATCTTCCTCCTCGTCTTCGTCAACAAAATCGTTGT
CGACCTTCCACAGACTGATGCGGCGTAGCTCTTCACAGCCACGCACTCCATTGCGATACGTCTTGAGCTGGATACCTTCCTTCTGAAGAGAGACGTCTGG
GAAATTGGTGTCAAGTAGCGGCTGCTCTTCCTCGCCATTTTCAAGGTAGACGTAGAAAGTGTAGTCATAGTATAGCAGCACAAGCACGACGCCTCCAATG
TGGATCTTGCTCGCAATAGCCTCCACATCCTATGCAGATCAAGCCCAGCAACGTTGAATGAGTCGTGCAGTTAATGAAGCATGACACTACCAAAGTGAAC
TGACCTGGAATGCAGCGCATTTGCCCATGGCAATTTCAAAGAAGCACTCAACATTATCATCCTCAAGCCAGCTTCCAACGTTGCCCGGGCTCTTGACGAA
CGACCCCCCAGTTTGAGCCAGTGTTTGCACGAATTGCTCTGCCTTGGACATCTCTTCCTGCATGGCAGGCACAATTCCTGCCAAGTGTTCCATCGACGGG
GTAAATAATGATGTCGCTGGCATCTTGGAGACTTCGCACATAAAGGTCTACGAAAAGCAAAATTGACACACGATGAGTAACACCGCGAGCAGAATGAAAC
TTGACCACTCGAACATTACCAGAGCACTTTGCTGTCGTCGAAGCATGGGGATGATGATAGGAATGTCTGACAACTCAAGCTTTGGTCCCAGATCCACGTG
CCCGTTGTAGCACCAGTTGCCAAATCGGAAGAGCACCTCGCGCAAACTCGGGGTGTTTGTGGAGCCTTCAGCACGAGGGGTGCGCCGAATGAGGAAGGTC
TGGTTGTAACCTGTGCCACTGACATCTTTGCATTGCACTTTCAGTGGCTTCGGTGGGCTTTTGTGTTTTCCGATACTAGCCGCCTGCCACAGCGTGAGCT
TTTTCATGTTGCTGCAGTCGTCCTCACGGTATGTCTGCAAGTGGATGCCCTGAAGGTGAGCCGAGAGGTCCGGGAAACGCACATCGAGCAGAGGCTGCTC
GCCGTCTGCTTCCTGCAGCACGACGTAGAAACTACGTTGGTAGTAGATTACCAAGAGCACCAACCCACGCACAAAGGTCTTGCTGGCCACGATGTCCACA
TCATCGAAGCATTCATAGCCACCGCTCTGCAACTCGAAAAAGGTCCTCGATCCACCATCGTCCAAATCGCCGTCCACCCACGTGTGCTCCTCTGCAGCTT
TCATCAGCTTGCGTTCAATACGCTCGCTTGAAAGCTCAGCGCCGATGAAGTCGTAGACATCGTACAGCGTTTCAAGAGGTGTCGAGTATTGAGACGTTGA
GGGCATGGCCTTCCACTCGCAAATATATTGTAGCGAAGCTTGCTGCTTCTGTAGGGCAGGTACGACCACCGGCAGATCGGCGAGCTCCAGGTCGGCACTA
CCGAGATCGACCTTCCCGCTGTAGCACCAATTGCCACAACGGAAGAGAACTTCATGAAGGTTGTTCTTGCTGGACCGGACGATGTACGTCTGGTTGTATC
CGTCACGCAGTGCCACAATCTCCGGGGTCGGGGCTCCCGAGTCGTCCGCGTTGATATCGGCTTCGTCGGCCTGCGCCTTGGACAAAGGCTTGTGCATGGC
CTGGGTTCGGTCGGCGTTGTCCTTGGCCTCCATCGTTGCGGCCTTCGCTGGTTCCCTAACTGAGCGAGAATGGAGGGACGCCAAGATCTTCGGTTGCGAA
ACTATCGTGGTCTCTAAAATGGGACGCACTTGCTGCATGTCAACTCGGAGCATGGCTCGAAACGAATGCAAAGTTTTGTTGTCGCATGTACGGATGATTA
TCTACACGGTGAAGCTAAGCTGCAGTGCGCAGTCTGACTAGTATGTGCAATTGGCTGACGCTCTTTCAGTTGTGGCAAAGCTACCACTTGTGCTGCTGGG
CCCACGCACCGGTCACCTTCGGGCCCGCAGGTGCAGCAGCACTAGGTGCCGAGGGGGCAGCGGGCTGGGTAAGTGGCTTAGCCCACGCGTTTCCAGTCGA
CTGGGAAGACTGTGGGGCCGGAGTGGGAACACCACCGGGCGGCGGGCCCCACGCAGCGCCAGGGGGAGGAGGCGGCGCCTGGCGACGGACTTGCGGGTTT
TGAACGCGTGCGTGGCGACCACGCATGATGGCCTGGATCTTGGTAGCTGCCTGCGCATCTGTCAACGGTAGAGCCTCCGGGAAGGCCGTGCCGATCTTCG
TGTCCTTGCCCCGGCCGAAGCTGAAGCACTTGATGTTGCACAGGTACGGGCCGAGCTGTACGTTGTTGTTCTCCTGGCCGTTCAGGTAACACATGGTGTA
CAGGGCCATCTCGAACTCCGGGCTCACTCCGATCAAGCTGCAAAATGCCACCACATAGTCGTTGTTAGTCACGTTGAATGTAGAAACCTTGATTGCAGTA
GCCAAGTTTCACCTCGTGGACACGGGCTTTATCTCGTCTTCCCACTGGAACTGGAACGTGATCAATTGCTCCTTGTTGTGGGGCTCCATAAACTTGCATC
CGCGCTGCTTAGGGCGAATGTATCCCCTGTAGTCGATGCGGCCGTTGCGCTCCTCGTTGTACACCTGGAGCCAATTGTGGCAACCGCACACTTTGCCCTG
CTCGGCGAACAAATCCATTAGCAACAAGACTAAATCCACTGATCAGATAAATCATCAATCTCACATTCTTCTCCTCGCCAACGAACACGTGCTCAAAGCC
CGACGAGTCGTTGCGCACTTCACGGCGGTACAGCCCGAACCAAATGAGCTCGAGCTTTTTCTTGAAGTCCCCCATGTCGCCCGTGAACTTCTTGTTCTTG
ACCAGCCAACTGCAATTGACCGCATACAGTCAGAACTACATCTACACCCTCACCGCCATCACCGCCATACTCACGCGTGGGCATAGCGCATGGGCGCCGT
CTCAAGCACAGCGTTCAGGAACGCGTTGTTCTCCGCCAACTCCTTGGGCGTCACGCGCTCCGTCACACCTGTCTGTGTATCACAAGGAGCCAATTACCAC
ATAACTCCAGTCACGACTCCACTCTGTTCATTGCACTCTCCAAACTGGTCGCACCTCGCGCTCGTAGTTGTCCAGCAGGTCGAAGAGCAGCTTGTACGTG
CGGCGCTCGAAAACGCTCGGGTCCACGAACGTGAAGAGCGGCTCGCGCGCCGCGTCACCGCGGGCGTAGGAGGTCTTGCCCTCCTGTAGGTTCACTTCGT
AGTGCACGTTGGGCTCCAGACGGTTGGTGTCCAGCTCCCAGAGCTTGTTGCACGCGGCCGAGAGGCTCTTGAGCTCGGCGACTGCAACGGCACAAGTCAG
CATTATATAGGATTTCTCAGCCAATTCATTGCAATTCGCCTACAGGTCGGAGTGGCGTTGGCCATGATGCAGGGGCTAGCGACTATCAGCGGCTCGAGGC
GATCGGGGAATGAATTGCATCCGTCCTGCAGCTGGATCGAGCGCACCCACACGCTGTCGTCAGTTGCTGGAACGAATGATACATGTACACACGACTGCAA
CCAGCGAATCAGCGTCGATAAAACAGCTGCTGCCACAAGACAAGAAATATGCCAGCCAATCAGTGTCGTCACAACGACAGCTGTATATACTTGTGTACCC
GCAAGATACTCGCCAAGATACCTTTTGCTTTCATGCCTTGCTCGTTGCTGAGCCCAGTTTTCCTCGGCAGACTAAGAGCAGGTCTCAGACTCACGCACTC
TTATCTGCAGCATCCAAATTGTTAATTGGCAAGCTGAGTGTCTTGGTTGTTCCGCTCAACGCGAGCTATCTCACCGTGAAGCGGGACGTGCAGCTCAAAC
TCAAAACTCAAACACGGCATCGCAGATACCACGCCTCGATATAATCGGTAATCGGTGGCATGCAGGCGACAACACGGCCCTGGTTTGACTATCAAGCAAT
GCATGAGATTCGACCCCGCCTCCACAGTAACGCACTGAGGATACACGTGGAGCGATGGAATTAGCCGCCGATGCGATCGCGCGGCGATTGACACGGGAGC
GTCTAAGGCATCCCGTTTAACAAGCCGCTAGCGGCAATGACTTGTGCTTGCAGCAATATCTACAAGAAAGCCTTGTACATGCTCGACTTATAAGTGATGG
CGCGCAGCGTTGCCTTGCAAAGCACGCCTGATGGCTCGAGAAGCACTGAGGGCCACAAGCAAAATGCCGAGCGCACCAGAAACGGATGTCCGTACCTTTG
TAACGAAGGCTTCAACACTCTCTTGTCCGATAACCTGGCCTCCAGAATCTTCAGTTTGGCTGCATTCAAGCCAGATACACTCGTCTTACATCATTTGCCT
CCGATCTTTCATCCTTTTCAGCATCGTTGGTGGTTTTGCAAGGCCAGCCTCGATGATGTGCTTGGCCTTGCTTGGCGCCGCTCACCCGCCACTCTCGCAC
TCGCCTCGCCGCGCCCAGAGCTCCGTCGTCTCCTGCCTCGCCCCAGCAGCTCCATGTGGCTCCGTCCCGGCGTCCTGCACACGCGCAGACTGCTCTTCTC
GTCCGCGTGCGGTCGCTCGCGCTCGTCTCTGGGCAGTCTGCGCGTCTTCACATCCGCCCGGGGGGCGTTGCAGGCTGCCGCAGCGCCGACTGTCCCCGTC
TCGGAGCCCCTGAGCGGCGGGTACCCCACGACCGCAGGTATGAAGCCGCCCGTGGACGACCAGCACGCCGTCATCGCCGACTTCATGCCCATCGTGCCGC
CCGAGTGTCTGCGCGTGCAGCAGGCCGAGCAGACGGCGCGTGGCGCCACCGTGGGCCCGTCCTCCTTCACGTCCATGTTCCGCGACATGTCGCCCTACAT
CAACTTCCACCGGGGCACGACCATGGTCATCCACCTGCCCGGCCAACTGGTCGAGTCCAACCTCTTCGGCGCCGTGATGCACGACATCGCGCTGCTCAAC
ACCTTTGGCATCAAGTTGGTGCTGGTGGCGGGCTCGCGGCCGCAGCTGAACAGGCAGTTGTCGCTTCGCAAGCTTTCGCAGAGATTCGACTGCGGCATGC
GCATCACGGGACCCATGGAGCTTCAGTGTGCCATGGACGCAGCCGGCTCCGTGCGCTTCCAGATCGAGAGCTACTTGGGACGAGGAATTGTCAACTCGCC
CGGACGAGCGAGGACGATCAATATTTCTTCCGGGAACTTCATCACTGCGCAGCCTGTTGGCGTTCGAGGAGGTGTCGACTTCAAGAACACAGGAGAGATG
CGACGACTGAACGTCGATAAGGTGCGCACTGCACTGGATGGCGGAGACATTGTGCTCATCTCCAGCATCGGCTACAGTGCCAGTGGTGAGGTTTTCAACT
GCCTCTCAGAGCAGGTGGCGAGCAAGTGTGCCATCCAGCTCGAAAGTGCCAAGCTTATCTTCATGCATAACGGCGAGGAGCTCATCGACTCGCGATCCAA
CTCCATGGTGCAGACTCTTGTGATTGAACAAGCGCAGCAGTATGTCGAGTTGGCGCGCCAGAACACGGACATTAGCGGCGATTTCCTGCTGTACTTAAAG
GAGTCTATCAAGGCCTGTGTGAACGGAGTCAAGCGCTCACATCTTGTCAGCCGACACGTGGACGGCGGCTTGCTGCAGGAGCTCTTCACCCGCGACGGCG
AAGGTCTTATGATTACAAAGCACATGTACGAAGGCATTCGGATGGCCTCTACCAACGACATTGTGAGCGTCATGCGCCTCATCCAGCCTTTGCTGGACGA
CGACGTGCTGGTGTCGCGTGATCAGGAGCAGATTGAGAGCAACGTGGACACGTTCACGGTTGTGGAGCGCGACGGTGCGATCATCGCTTGCTGCACACTG
CAGCCGTACGAGAACAACTTCGCCGAGATGGAATGCGTAGCCGTCGACCCGACCTACCGCAACCTCGGCAAGGGCAATGCTTTGCTAGGATATATTATGC
GCAAGGCAGCAGCCATGGGCGTCACCAAGCTGTTCGTGATGACGACCCGAACAGCCCACTGGTTCCTGGAGCGCGGCTTCGTGGAGGCTACAGTGAACGA
TCTGCCTCCGTCGAAGCTGGCCAAGATCGACCTCAAGCGCAAGTCGAAGGTCTACATTTGCGACATCAGCACGAAGAAAGCTCTGGACGAGAAGGAGCTG
CTGCTTCAGATGGAATAACTCGGTGCGCTGCCAATTTTACGCTCGACCGACTTTTTGCCTATCGGTCGGCACCGCGATTCCTTAGAGCGGATGCAGGAAA
GCGAGCAAGCCAGTCATATTTAACTCACAGAAAGCTGCTCGGACATTTTCCCTCCCAGTCGTTCCCATGACTTCCATCTATCTGTTGACTGACGCTACTT
GGCAAGGCCGTCTCGCGTTTGGCAGGCATAGCCTGTGTAGCCTTGAAAGCAGGTGCAGGTTCCCGCCTTGTAGTTACACACACCGCGGTTGGAGCATTCT
ACGAGGCACTTATTCCCTGCAGCGCCAACGGCAGTGCCGCCAGGAACAGTCTTTCCCTGGCAGTTGGTTTCGTCTACAGTTGTGTCCGGGTCGTCTCCGA
TGGGGCAGTGTCCTGTTGAAGTTGACACCAAGTTGAAGTCAAGCTGAAAGTCAGATGAGTGCAGGTCTTTGAGCAATCGTACGTTTCGAGCAGTCCGCGC
TGAAATACTCCGTGGCTTGCAGCTCGCCGCTCGCCGCCCCGACAGCCCAACCAGAGTCGCAGACACACCCAAAAATCCTATCGGCGTCCCAGGTCGCGGA
GAACTGCAGGCGACAGACAAAATGGTCAAGGTCGTGCTCCAGATAGCAAGTTTTGCTAACGGACGTACCGGTTGGCCTCCATAGGTTGTTGCCGCAGAAA
TGGGCAGTGCGTTTTTGGCGGCGGCCATTTCGCGCATACTCATGCAAGTGCCTCGGTCTGAGCAATCGTTTGGGCAGCCCACTACATGCACACAGCAACA
GGCGACAGTGGCGGTGAGCAAAATCGAAGTCTCACAACAACGAAACACGTACTTCTCTCGCATGCGGAGCCTTCAATGCCAGGAAAGCACATGCAGGTCC
CAGTGCTTCGGTCGCAGATTCCCATGCCTGAGCATTCTACTAGGATGTCATGGGCAGTGACAGTGTCCGTGGGAATGGAGCTCCACGCGTAGTTCGATGG
GCATACACCTGCATACATGGACGCCAGGTTAAAATGTCGACCTCGTCGGCACGAATCTGCTTCACATACTTACGCGTAGAGCAGTCTGGTGATTTGTAGT
CTGCAACGTCCGTCGGCGCACCCCATCCAGTGCCACAAATGCACACTTTTGATAGCAGCGTGCAAGTACCATGACCACTGCAGTCGTTTACGTACGTGCA
ACCTTCACCACCGATGGTGCTGCTCTCTTCGATGGTATTGCCGCCCGCATCTCGAGTGCGCACAACAAAGTTCCCAACGGCCGAGTTAGGAGGTGTGGTG
ATCTGGTCGACTGTAAATGAGAGACCAGTGCTGGGCAAGATATTCGTGCCTGCAATCTTCAGTTTCACTGAGCTCGATGTCGCAGTGAGCACGGAGCTGG
CAATCGGAATCCCAACCAACGAGCCTGCGACGAGCGTGGCAGCCCCGACACTGTAGCCATCAGGAAGCACAGCCTCAATGTAGCCGCCAAGAGGGATGGT
CGCGACGGTGTCTACTGCCACAGTCGCTACTGTGAGTGTATCGGGGGACCTGAGTAGCGGACGCACGCGGCCGTAAGTAAGCGGCTTCTTGACGATTGGC
GTACCGGGTATTGTCGTTAACTGCTCGAACAAGTTGCCCCCACTGTCGGTGATAGTCACAGTGTACGTCTCCCACGTCATCGCGCAGTATTCCACGATGA
ATTGGTCGCACGAAGTTCCGGGATTCGTAATGCCCTCCACAGTAAATCCGCGGCCAGTTCCTGGGACTACAGCAGTGTTTCCTGTTATCATTCGTGTCTT
GGTTGAACTCACCGACCCGAAAACAGTGTTCACTGTGGGTAGGTTCGTGGTATGACTGAAAGTTACGGCGCTAACGTCGTACCGGGCCGGAAACGTAACA
TCAACTCGACTACCTGACGGCAAGTAGGCCGAGTTGGCAAACGCAACAGTGTAATCCGTGACAATACCGGCCCAGTAAGATATGGGTGTCACCGTCGCCG
ATGGAAGCGTTGCGCTCGTGTAGGTGAGCCCAGCCACTGCCTGGTTTTCCTGGAATATGGCCCCGGTAGGGTGCCGTGTGTGAACTCCAAAAACTCCCGA
GGCTTGAGCCGCCGGATTGATAATATTGCCATACGTGATCGACACGCTCGTTCCGGCAGCAACGTCTTGGCCAGCAATTGTAAGGCGGATATAAGGCGAA
GCCACTTGCACTATCGTCGAGGCTACAGCAATGCCTCCCAGACTGGACAGTGTCGCGCCCGTGAAGACAATTGTGCTGGCACTGAGAAGCGGGAACTGCA
GTGCAATCACGCTCCCAACGCGTAGTGTGATGCTCGTCGTGAAGGAGATACTGTACGCTGTCGTCGTGCCGGCAACCAGTGATGCCGCTGTCACTACCGG
GCTGGAAATCGTTCCTAGAGTGATCATCGATCCCGGTACAGTAGCTGACTCGAGGGTCGAACCGCTTGCACTTTGCGTGCGTATCAAATACGTGGAGGTT
GTGCCCGAGCCTGTAGTGCCTGTAGCCAAGTTGGTTTTACATCCTATTAGTCTTCGCAGCTCAAAAACCTCCGTGTGTCATTCGTTTTACCTGGATTCGA
GATACCGTCGAGAGTGAAGGCGATCGGTCCAGCAGTAGCGTCCGTACCGGCCACCGCGATCGTGACTTGTGCGCTGGCAGGTGTTGCTACCATTGAACTG
CTCAAGTCCAATCCCGAGGTGATCGTGAGCGTCGTGGAGGCTACGTAGAAAGTGGAGGGGAACATGACCGTGATCGTTCCGCCGACAGGGACGGTAGTGC
CTGTCGTAAAGGCCACGCCCACATTACCCGTGACGCCAGCGACAAGAGACGCAGGTGTGATGGTCGCAGGCGCGATGGCTGCATATCCTCGCTCTGCGCA
TGACAGCCACAGCAGCAATTGCAGCCACCACATCGCATCCACCCTTTCAAG