Description :
From Genome Similarity Track
Location :
Scaffold_40:331948- 337257
Transcript NameFunction/comments
Phyca_LT15349660Hypothetical protein

Sequence
5309 bases(100 bases per row)
catttgcttctctatcagcgatggcaaggtgctcctccgttgttgtacagaactgaagttctgtgcaaatagccttggcactcatacccttggtgataga
atcaatcacgaagtcaaagtccttcacgtaaatgtggcacgggttgtccgaacccaacatatcacaaatcatgtctgcgtacgcgcgaatttgacgaata
tcggtgccatattgctggagcgcaatcttcgccacagtggttgcaaattggcaatacgtgcactgagtcgcgtttccaggaggccattgagaagccacga
ccacacccttcatttcatcggcaatggaaggcttatcttcctcccagtcttgcgtcttgttacaaaccccaagagacttgcagatttcgtgggggtgctt
gccttccttctccatttcaacgattttgtcgaagtttttgtctactacatcgcacttgcacttcgacggcaccagttggcatacgtttgtcaaaatggtt
ttcacaaccggcaacttttctggcgacgtgtgattaacgtggtggataaccattgcaacacgcgagcagaaaaagcaactaccgtggggatgcgggcgtg
ggtggggagggtggggtgggtgttcatcatcttccaagttaccacgcgggctaagatcgtgacgtccatggcggcctccgggacccaccatactcacacg
gtgatgcatgccacgaggaccatttctcatcataccgacacgaaggttctcctccaactcaagagatttgtccatttgttctgccaagcagtatttcaga
gtcttgcaaatgtcacgagggtgtactcccttctttaaggagtcaaccacgatatccaactggttcacatactcgtggcacgggctgtcatcccccagca
taccgcaaatcatgtcagcgtagtcacgaatttgatcaatctgctcaggggcttcttgtagaatgacctccacgacagtagtggccgcgtcgcagtacac
acacgtcttgtcgccgcggatcgaatgcgagggtgtcatgctacgtgtgggtttcgcagggcagaaatcagcactagcacaaacctcacgtgggtgctga
ccttgctgcactaactctacaatacggtcaaagttggcctccacttcttgacacttggattccggcgaagccatctcgcacaccgttcccaataccgact
tcagcatcggaagctgttcggggaacaactcgttaacttggtaaacgacaccagctacatgactgcagaagaagcacgcctggtcattcgaaacaaagtc
agcagtaaccagagccgtatcctcgaccgtcttgggttcttcgggggtccatggcagatcagagacctggcttccactgccgctgtctggagtgcacata
gcgatccgagagcagaccaccagcgggtcagtgccgtgcttgagccaatccacaatagcgtcgaagttcttaataaacgtgtggcacattgaatccgccg
acatggcgtcacacagatcgccgatgatagctcggacctgctgcacttgctgcatttggtcgaccagcgcttggtccaccatctgcacgaatctctggca
caacttgcaggacaaattgtccgtcccctccagatccgtgacggtggacatgatatcgcagacttggtcgtccgtcttgccctcctgcaggaacttcctc
acgacattctccgactccaacacgacattgcactttcatccaataaacaattgcatcagtacacggttccttcacttcaacaacaccatttctcacctgg
gtaatcagatcaggctgttcgagatcctcacacgacgtctccccccaaacttgcagtgagaccatgtcaaaggccgagcggaagtacttgacaagcgtct
ctgcctccgtctgcagctcgtcctgctcgtggatccgctccagcgccttcaagcacgcgcgcttccttcctgggccggatcttcctccacctccagcact
acaatgcgcacggcgtcactctggggctcttccaggcggaagaagctctgtagcagctcactggagcgctgaaactgttcgttcaatgcactcatgagtc
ccatagtaaagtcgtcgccctcgctcttctgttcgttgtggcacggcatctccgcgtcttctgggccgtgacgcacgctctgcatgtgctcggcgctcgc
tacggccgccaggctcagcagcgcgtacacaggccgcatcgttcgatccttaagtccttccttcttcaagctcgaatcctatttgaaggggacatgcgtt
agactccagtgtcaggatggatgacatttacagagatgggatgcacgtctctatattttccgttcttagtaaaatcaagtgtaagttggatttttttggg
gcggaaaatgtctgagtcaagtgacaaattaagaggatcaggttgtaagactgggtgtcaactatatgaacttcgtcgtggaagaatgatggttgaagtg
gcctagccaatcagatcgagcagttattatgatcagcggacatgatcaacggatatgatcaacatgctcaactaacgttgagccttgcagtgagctgtag
gtggccaccctgagtagaccgaggtatccacaacaataacgatcctccaccagtcccaggaagtcccaggaatccctgtctagatacagcgttttgcctc
ctagagctgtcacgtttgaagtccaagtgattgtctttccggctggaactgtcaccttgtcaatcttatagccaccggacttgatattgactgtcacatc
ctctgtatcaacgctccggaaattaataacgacagagccatcgccagactttgtccagttgccactgctgcccttgaaagcattgtcaactgtcttcaaa
ccgagagcgtcttttgcacttccatcgtcaatttcccccatgaattttgtaggtccacaaattgtttggaaatactcggagacgatgccagcgatattgg
tcagatcccatactgcgtagaaagtaagtgccttgtccgcgatcttgtaggcgtatttttctgctgtaaggagagctccattgtggctggtaccggagcg
aatcaagtcgtccatgatgccaccgaagctcttacggagagtatcccgcgccatgtaagctgcttttcgtcggattcgtcgatcagctcccccatgcagt
tgttggttaccgtggggatctcgttcaggacaagattcgacttgctcatttccacgcggatttcatcctcggagatcatggggttatccttacgaaggtt
tgctacagttatccacgtacggtccaggagacgcttcatgttatatccgcaagaggaatgtgatttcagcgccgactgtagcgaagaaatgtccgagtct
tctagctcctccatcggttcgtcgagggcggttcgcttcatgaatgctaagaatgcagcccagctagcgaggatcgcgtcattgttcgtcactatttcct
tcacgaagagttcgaccgtgttggttatcctgtcggctgttctgacacttccgacacgtgcatccctaaacatgtgcagattgtaatcggcaagtcgaag
acgacgttgtcggtttgatagagcactgtttccaggtattttccgtgctgtgtgggtgggaaactttaacagttcgaagaaacctggtcaagtgcttcac
tagattcatcgtctctttgccacatttgtacgcagttttcacgcctttcgccatcaacttgaactcgccatataagccaaatgtggcaagggaaaacgcc
gaatgagcgatgacggaaactttggaaacgacttcgagcccacagtcatcattctggcggatacactccatgccacatttcacggggtatgatagaggac
attcagcccagcaaatgccgtggtaattgtcgaattcaagaggacacgactccgcaatgtgggcttcacggtagcacgctgtatcgggagcacccccaag
cgaaggacccacccaattcgtatatgttgacttaatcgtggatatgacagctccatcggttgatccagttggtgtgttggctccatcgtcgctgtctaaa
tcctcgtcgtcatcatcacgattgaagatttcatcgtggctatcatcacttgaatcattgtctccatctggaaagtttacatggcttggtggctccgaga
tggcaatctctgtggtaaccaatgaatttggtgcggcatcacggaagttgtaagcttgggcaccagatgcattgagcgcaattcctgcgttcaacagagc
gaagatgtgtatcaacttgagcatcttgattgtcttgtggaagtgagcgcaaatgggaaaataagtgaatgttcggaggatattgcctcggttacaaaag
tttgctacatcaaagtactagctgctcgtaaaacgacttcccttctcaactcgtcgtcggctaagctcgttgtgcaaactctgtgtgtatgcaaagcggt
agagttgtttctatgatcaacatttagcttttcacttcgcggtcgtcgattccggtgcaaaacccaacctacaagattgttccctcggatcagcggggtc
agatgattttctcttggttgttcacgacaaatatactgcaggaacgatggatgcacggtcgtacagactaccatgtcttcacgccctactggctggatct
aggataacgattacttgttgcctggtaatgggagtccggttttaaggaacaaaaagacgcaaacttcaggattggatttttagatctgctaaacaactcc
atcgcaggacccgtctcatgttgtgtacatgcacatgtacgtgtagcccatgtcaacgctatagcccgcaaggcgtgacttactactgaacctgaaaatc
aatccacacacacatttcactccttcgtgctgtgtattttcaaagtctataccatacttccaaaatccacatcgttttaatcgacaggtagcaatttttg
gggtgggcaactcgacgggaaggttagtttgattatccattctgcaatttaccacacagtcgtctgagtttcggtacgaattcaaatgagacgtgcccca
tgtcccccctctttgccatcaaagctctggtaatgtcagcagattaagcacggagggatgtgcaagcaaattaaataccggacgataccacgttcatgcg
tcgcatcagaccacaacaatacacacttcaatacatgcacatgtacctcactcaactagacaaccaattttctagcattggttgttgatgtggcaaaatt
tgtggattt