Description :
From Genome Similarity Track
Location :
Scaffold_57:331929- 336616
Transcript NameFunction/comments
Physo_137805hypothetical protein
Physo_137806reverse transcriptase

Sequence
4687 bases(100 bases per row)
TCGGCGTCATCGTCTCCCGTGAGGAAGTCGTCGGAGAAGCTCAAGAAGTTGCCCAAGAAGCGGAAGGAGTCTCGCTGGACACGAAGTCGTTCTGCGTCGA
TGCCTCGCGGCTCTCCGGTCTACGCGCTTCATCGGTTCCAGTGTCTCTCCCCCCACGAGTCCTGCTCCAGTCGCGAAGGCTACTGCGCCCTCTGTTCCTG
GTTCTGCGCCGTCTGCTGTTTCTGCGGAAACTCCTGCCAAGCTGTTGTCCCAGTCTCTGGTTCCGGTGATGATCCACAAGTTGGTGGCTTGAGTCATCGG
GCTGATCGCGGATGGACGGACGAGCAGTTAGCTTCAGTCGAGCAGTCTCCGGAGGTACCTCAGTGGTTCGGAGATGACTCGGATGCTGGATTGACGGAGG
GTCTGGTTGACGACTCAGTGGTTGGTGGCGGTGCTGCTTCTGCTGATGAGGAGGAACTCGACGAGTGGTAGGGAGAGCGCGTTGAGGTGGTTACTGTAGT
TCCAGCTTCGTCACCTCTGGTTGCTGACGGTCTGTCGTCATCGGATTCCACTGATCTCTCGTCACCTGCACCAGCTCTGCCTCCTGCCAGCGCTGAGTCA
TCGGCTTCTCTTCCGCTTGTTCCTGCAGCTTCTGCTGAGCCGGCGGACACCTCGGTCGCTGTTTCATTGGCTCACCGGCCTGCAAATGCGGCATCTCAGA
AGGTTCCGACGACTCGTTCCCGAGGTAAGAAACCGGCTAAGTCTCGCCATAAGTTGTCATCGTGTCAAGTTGTCACTACGCAGTTATCGGCCCCAGGACC
AAGTTCAAGTTCTGCGCGCTCTCTGTCTGCCTCGCATGCAGCCCGAGATGTGCTGCCCACTGCTCGTTACTCCAAACACGTGTTGAACTGGGCTACTCTA
TACTTGGCTCCTGAATTCCGGTTTCCTGGCGCTTCTAAGTGCTGGATCCAGATTGCAAGTTGCCGACTTCTATTCCCGGGGATGCTCGGATTGCTGCCAC
GACTGCTGGTATCAAGGCGTTTAAAGACTTCAAGAACCCGTACCACCCTTGGCAGCAGCTTCGCCGGCGTACGCATATTTGTTCGACACCCATGGATTTG
ATCCTTCTATCAAGGTCTCCCAGCGAGCGCCCCCGACGACTCGAGTTAACGAGTATTGGAGCAACTTTCGAGGGTACGGGGATCCTGACGATATTGATCT
TGGGTTCTCGGATTGGGAGCGTTACCACTGGATTCCGGCTCCGGCCGTGGTGAATTGCTTCCGGATCGCTAACAAGGAGCTGGAAGGGAATAATGGGCCC
CTGAGGCGAAGGCCAAAGTTCGAGCTGAGCTGGACGAGGCCAAGGCTGAGTGGTTGGCGTATGCTGCCGAACGGAACAAGCGCTGGGATCGGTTCCGAGC
CAAGATCATCTACCAGGTCTGGAGGTGGTTTGTCAGCAAGGAACCGAGGTTCGCTGCTCTCCACACCGAGTCTTTGTTTGAGCCTTCTATGCTGGGTTGC
CCTTTCGACAACCTCACGTGGCTGCCCAAGACGACCGACTGGGTCAGCGAGATTTCAGCGTTGGACGCGGCTGAGCCGTGGCGTAATGGCTGGGTGGATG
TTCCTGCCCAGCATCCGTACAACACGACGTTCTTCCCCTGCAATCCAAGGTTTCCGCTGTTCGTCCCTGCAAACACCACGCGCGAGGAAGTCGGGCGCCA
GATCGTCGTTTGTCCCGACCTCACGCCAAACGAGATCGCGGCTGATTCGGATGATGGTTTCTGTGAACTTGCCCAAGCTTCCGACGAGTCTTCGGGTCCT
GAGCCAAGCGAGCCTCCGGCGTCTGCAGCTACTTCTCACGTGGCTCTCGACAACTCGGACCACCTCCGGGTGCTGGCGCAGGCTGCAGCTTCTGCTGAGT
TGCAGGGTGACGCTCGCGAGGATCGTGACGACTAGGAACGGTGAGTCTTCGGGTGCAGGTGTTTCTTCCACCCAAGCTGTTTGAGTTTTCACGGTTGTAG
TCTTAGGCGCGTTCAGCTTGGGGTATTTAGGTTTTCTTGATTCTTCTTCCAGATCGTCATGTCCAGTTTTAAAAAAATAAAAATCATGCAAGTCTTCTGC
AGTAATCGTCTTCGTCTGCGTTTCTGGGCTGCATTGCCCCAGGTACAGGTCACCATCTTCCGCAGCAGTCATTTTCGTCTACCCTCCTGGGCTGCGCTGC
CCCAGGCGTAGTTCATCATCTTTGAGTCGTCGCGAGCGAGCTCTAATCTTCGTCCGTGACCTGTACCATCTGAAGGCGTTACTCGCTTCGCTTGCGCCTC
AGGTAGTCGTAGAGAAGACCCCCACAGGAGAGGTGGGTGACTGGTTCCCACGTGGTCTCGTCCTGATCTGCCCCCTTGCTCTTGAATTCACGCACTGAGC
TTACCGTTCTTGTTGACATGGGCATCCGATCATCCAGAATCTCCAACACTTCGCTCTCACCGGCCAGACAATCAGGTTCCCAGCTATCTTCGGGGAGTAA
TTCCTCGTCGAAGTCCAACCGTGAGTCTTCGGTGATGTCAGGCGCCAGTCGAGTCTTCGGGCGGTCTTTGAATTCACTCACCGGCTTCAACCGCGAGACC
GGGTAAATCCGATAGCCGCTCCGGTTCGGCAACTCGAGCTCGTAGGCGTACTATTCGACCTTCTTCTTGATCCGGAACGGGCCGTGCCAGCGGTGGGCCA
GCTTCTTGGTCAGCCCCGGCTTGACACGTTCCATGTACAGCCATACGCGACTACCCGGCTCGAATAGAGACATCGGCGCGTTGCTTGAGGGGTCTGAGTC
CGCGTCCTGATTGGTTGGCGTTGCTGTCTACGACTTGTTCCTGCCAGTCGTCGGGATGGTTGCTCTCTCCTTCCGGCTCAGTGCTTCGTTATGTTCGCGT
GCTCGGCGGGCTTTTTCAGTCGCTTGGTATTCCTTGGCCATCTCGAGTGCAATCTGGTGTTGTCGGTTGACGTCCCGGCGCCACGCCAGCGCGTCGGATT
GTCTGCTACTGGCTCTGCGGAGCGATGACGACATCGCTTTCAACGTCGACAGAGCGTCCCATCCATGGACGAGGAAGAATGGAGTTTCCTTCCGTGTCAT
GTCTTGTGAGTTGTTGATCGCGAAGACCAACCGTTCCACGATCTCGTCCCAGTCCTGCTGAAGCGGGTCTTCGGCGTACACTCTCACGGATTGAATCACC
GTCTTCACCGACCTCTCTTGCTGCCCGTTGACTTGGGGCCGATAACTCAGCGTAGCCCGCGACCTTGAGTGCATCATTTCGGCAAAGGCCTGGAACACCT
CGCTCATAAAGCGAGGATCCCGGTCGTGTCTAACCAACGAATGTGCTCCGAATCGTCGGTATATACACTCTTCGAAAGCTTGGGCTACCTTGAGCGCTGT
CGTGTCCGACATTGCCTTGGCGATCACAAATCCCGTGAAAGCACATTGGAACAGGAGGAGGGCAGTGTTGCCTCTCCGAGTCATCGGGAGCGGTATTACG
AAGTCCATGGACACAATCTGGAGTGGTCGCTCTGCCAACACGTTGCCGGGAGAATACCCTCGCAACTGTGGTCGGCTTTTGCTGGTGCTGCAGTCCGGGC
ACGACTTCACATGCTTCTCGACGTCTGTGTAGAGGCCGAACCAATAGTAATCCCGCTTGACTCGCTGGTAGGTCCGCACTACCCCCTGGTGCCCGCCTTC
TAGCGAGTCATGGCAGTTCTGCAACACTTCTTGAATCATCGTGGTGGGTACCACGAGACGCAGCTTGATCCCCTCTTGGTCTCCAGACGTGTCTCGACGA
CTCGAATTCACATTGTAGAGTACTCCGTCGTCGGACAGAACGAACTTGTCCGCAATTTTCCAGGCATCTCGTGCAGCCCTGTACCCGAGCTTCTCGACCT
CGCCTCGGAGGACTGTTTTCTGGTTTTCCCACCGTAGTTCCTCGTCCTGAGCGGCTGCTATGCGCCGTCGCCTCTCCGCTTGGACTTCGACGGGGTCAAT
GTCTTCTGCCTTTGGCGCTGCGGGCGGTGCTTGAGCTGCTTTCGGTGGTCGTTCATCAGTGTGCTCTTTGTCGGTTTGAGTCATCGGCTTGGGTGGCGTC
TCGTTCGTACTGTCGTCCGCAAATCGGACTCGCTTCGTCTTCGATCTAGCCTGTGAACGAGTCATCGCCATGATCCTGAAATGTTCTTTGCGCACGAAAT
CAGCGAATGTCCTGGGTTGGTGACCTCGTATCCGTCCGCAATGTGAATAGAGCCTCCAGGAACATGGTTTTGCACTGTTGCTTCATCTGGCGTCGACTCA
TAGATCACTTCCTGGATGCGGTTCCGTTCGCAGAGCTCTGCCTTCCGAGTTTCACTCAGGACCACCTTCGACGTCTTGGATTCAAGTGTTTCCGACGCCA
ATGAGTCTGCGGCCGCATTGAATTCTCGAACCACGTGCAGGTACTTGACTGACCGCAGTCGTGCCGTGATTTCCTTGTGGCGACTCAGCTGAGTCATCAG
CGCCTCCTTCCGGCATGCGATCACCCCTAGGGATTGCTGGATCGCGAGCATCGAGTCCCCGACGATGACCAAGTCTTCGGCGCCATGGTCCAAAGCTGCA
AGCACTCCGTTGGTCATGCCAGTGAACTCGGCGAGATTAACAGTCGTCTTCTCGAGGTAAGCGCTCGCCGCAATCACTATTGTCCAC