Description :
From Genome Similarity Track
Location :
Scaffold_478:3319- 8019
Sequence
4700 bases(100 bases per row)
TGTTTTGATTGACTCGACACCTCGTACCTAGAGTATAAGGATAGGTACTGACATTTTTTGTGAAAACTGACACACCCAATCAATGTGTCGGGAGAACGGT
GGTCCGAAGATCTCGAGGTGGCTCAGGTTTGGTGCCAATGCATGTAGCGGCGATCTCGATCTGGACCCCAACGAAAAAAAAAATTTCGTTTGATTCTTCA
AGGCGTGATCGAAGGCCACTGTAATTTTTAAATCCTTCCGGATCCCTTCTTCGTGCACAACCCTGAATATCTTGAAAAGTTATCATGGTATCTGGGTTGT
GGTGCAAGCAGAAGACCATATCGAATCTGGCTACAGCGTTTTAAGGCTGAACGCTACCGAGCCCTGGTGCAACTAGTATCGATCGTCCCTTGCAAGTCAT
CTTGGATCATCGATCTCACGTCTGTCTGGTGAGTTTTTTTTTGCATGGTCTCCTAAGTGATCTCTACCGTCCTTATAATTTACTATATTTTCATCTTGCT
ATCTCGTCTTGTTCGTTCTTCTTTAAAATACTTAATTTCTTTCTGCTTGTTTTGCCGCAATCTGACGCTTGCGATCGCTAACTGCAACTCACATACTTAA
ATAACCCCTTACACAATCTCATGCAACCTCCTTGCACCGATACAGCCACTCCACCTTTTTAATTTTTATTAATCTTCGGCTTTCGCTTCATGAGATTGCA
TCGCCTCGAAACGGTTCTTGCTCGCACGATCATGATCAAATTTTGGCAGGAAGGTTCCACAGTTCAGATCGGCTTCATCAATCCAGAAAGGATTACATTT
ATTTTCCATTATACCAGATAATGCCCATGGACCCTCCCATATCGGTTCTTTGGTCCCTAGTGCGCATCAATTATCTTATCCACTTCAGATTCATCTACGT
CCAGATCACCCCCAACTATATTCTTGTAGTAAGGAGTTATCAAAATCGAATCCGTCCGCCTCATCAACATTGAACGATTGGTAGGGACTTTTGGGAATGC
CCAAACATGCTTCAATTTAGAAACAAGAGCTACGGGGAACAATAGGCAAGGTATACCTGCAATCTATAAACGCACCGCGTGATAGCCACATCTTTCAGCC
ACAAGAAACGGTCCATGCCACATATGGGTTAACATTTGAGTATATTACTTCTTAGCGCGATCCAGATACATCCAAACCTACGATCCGCGACAAACATCCA
GTAAGTCGCGATCCTTATTATGAATATCGTCTCTATCTGGATTGCAATATTAAGTAGATGTTTCACCACAGCCCTTACATGCTGATACTGGGGTCGTATG
ACATATCGCCATCATCTTGGGTTCCGATAACGAGGTTTGGTGCTTCTTAACGGTAGGTTTGCTTTTAAAGCTCGTTGATTTCAACTGAAAAACAAGTAAA
AAGACGAATCCACACGGACTCCATCCTACGCGTTGTTAATTGCATAAGTTAATTGTTCTGCGTATTAATGTCAGTCCTTTTGATTTTCGTCCATGACATA
AACCTTAATCGCTGGGGTCATTATCTGCACCATACTTCCCGCTGTACCATTAGCTTGTGGCAAATAAGCCATGGTGGCCTGCTGTTTCCCCGCAATCCGA
TTAAAAGATTGGAAGGTAGTGAACACAAATACGGCTACTGATCGTGGTGCATTGCCTCGATTGCACCAAACCGTCTGGATACACATTCCTCATACTTCTC
TGCGATCTTTTGTGCAGTCACAAAATAAGAAAAGAAAAACAACCCACAATACCAGATCTGTATTCCCTGAAAAGTATCACGATAAACAAGAAACATGATC
GATAGCCACAACATTGAAAGGGTACATCACTAATTGTAAATTACCAGGTGATCTGCATAAAATTAAGTGGTCTTCTTTTTCTCGTTTTTCAGTCAACACA
CTCTCTCGACTATCGTTGCACGCTTCTGTACAAGGTTAACCAATGGAAATTTGCCCTGATCCATTATTAGATGCAATTGCCCCTTGGGGTCAACCCTCCA
GACTTGTATGATAGTAGTGCAAGAAATCTTGCTGTAGTAGTTCTGCGAACACCAAGAAAACCGCTTCAGTACTATCCTCCGATTAGGCGATCGATATCGG
CAAAACAATGACAGTCCACTTTGTCCTACCTCATCCAGTGCAATCAGGATGACGACCTTTGATTCTGCCATTAATAGCGTAGCCACATCTCCTGTCAATA
ATATGTTTATAAATTGAATATTCATTCTCTTGACCTTGCGCTTGCTTGACATGATCGATCCGTAGTTTCTATACAGCCTCTTCTTGTAAAATTTCGTCTG
GCAACGTCTTTCCTGGTGGATCGAGTGATAGTATCCACTTTGACCGTGTGATCGGTCCGTTTTGTTTGAGCAACTAGCTTAATTGATTAATAGTGATCAG
TTCCTGACGATTTTGACCATATACCACAACTTTCCTCATCTCTCGGTTTAGAGCGTCACCCGCTATCCTATCTGACCCCTGATTTCAGCTCCGCATCATA
ATAAGAATCACTTTATTGACCATGATATGAGTCGCTTTTTAGCTTGATGACGTACAAAATTGTAGTCCTAAGGCATTGCAGTCGATCCCCCCTCGCATTT
GACATATCATCAAATTAATCCCCACATATAACCCTTCACCCCCTGGTTTGATCAGGAAGCACATCGAATCTGAGGAGTAACCCTATGCCCACCGCCTCAT
TCACATTCAGGTCAAGGATAAACTTGGAAGCACCCTCTACGATATCCAATCGGGAATTTACATATGATCGTGCTGCATGCTCCACGTTTCCTTTCACCCT
AGCTGATCCCTAAGAACTCAATATTAGGAGGTTTTCGTCTGCTATGGCTGTAGGTTGGGGAATACTTGTCGTCTTTCTCGAATTTTTACGTGGGGCAATA
TCAGCTAACACCTCGTCCAATTTCTCTGAAGGTGTCACACTCGCAGCCAGTTTACCCAGCAGCTCCACTTTGCCCTTCTCAGATTGACAAAACTCCATAA
TTCAATCGATTAGCAACTCAGCCCATATTTGTAACCGTTTGTTGAGGTCAGAGGATTGCAATAAGCATGTCATTGGTGAATATCGCGTAAGGACCGTAAT
CCCGCGTGATACCAGCATGCAAAACTATCGAACAATCGAGGAGATATAGCACCTCTTTCTCGACTATTCCGTAATTAAATTCGTTAGGCTTCAACGTACA
ATTACAACATGTTCGGCCAATACACCCTCTCATGCTCTTGGAGTAACGCAGCCGATAATACCCACCTACTGGCATATACTACGATCACATGCCATTCATC
GAGATGGAAATGTTACAAAATTAGTGTTGTAAATATTTTAGCTTTTTATTAGCGTAAATGCAATTTCTGCCTTCTCTAATGACCCCTGCTCTCGGGATTG
CGATCGTGCCCATCATGGAGTGCAGATCGCGATCGTGTTTCAGTCCGGGGTCAAGTTTGGAAGTATGAGCATCCCTCGTGCGGCTAATTTTGTGGATATC
TTTTTCATACAGCACAGATGCATCGATAGCGAAGTCCTCAATAAATATTCTATAGTCATTTAGACTTCCCGGAAATGTTCGCATCAATCTCCACGTCCGA
GGAAATGGGGGTATTCACCAGCAGTTCCAAATTGTTCGTATTAGCTTCAAAACCGCCAGCAAAATTGATGTCCTAGGTATTCCTACCGTACGACGTCCCA
AATATATAAGATAAGTTGATCGACAGTATCCACTCATTGCATCCACTCAAAAACCGCCAAGACTTTTTATAGAGGGAATACCACGACCTGGCAGGTATCA
GTATATAGTCGGTATATAATCTCCGACCCAATACCGACGGACTTGGGTCAATGTCTGGCGTCTCTTCAGTGAACGCATCGATATATTTTGACAGTTCAGC
CATGATCGAGTAATGTCCCGCAACAAGTTTCAAATATCCGTACAGAACGTTATCGATCAAGCACTTGTAAATCTGATGAAATTTCTTCAATTCAAAGGGC
GTCCGTAACCACTCAAATAACCCTGACGGTGTGATAAATGCGAAAATCTACCTCGCTCGTTCTGTCATCTCAACGACCTAAACTCTACTCGCCATAGCAA
GGTAGAAATACCAATTTCATTGCTTTATCCACGCCCTCCAACAATTCACTAGTCAGAGTAATAGGGTATAACCATCAATCTTGTCAACTAATTTCACCCG
CCTATGATTAATACACAGCTTTATGTCCTCGTCGTTCATCTGGGTAATTACCACAATTGGCGAAGCCATGAGAGGTGGATGACCGTATGATCATGGCCGA
TAACAATCCTTAATTAGATCAGCAAGCTCCTCTATGAATATTAGGTGGATGACCGTATGATCATGGCCGATAACAATCCTTAATTAGATCAGCAAGCTCC
TCTATGAATATTAAACTTACAGTATAGACCATCTGCTCCGTCGGATTAGCCCCTTCCACATCGATAACAAAAAGTGATTCATGCGCCGCAGGAGTTAGAG
AATTAAATTGCCTAATGAGTGAAATACGGCTTTTCCAAATGAACTGACGTTATCCTAAACGTCCGTCGTTAGCACTCCTGGACCACCTACTTGAACATCT
TCGATCGTTATCTCTTTAGTAGGTGTCACAACTTCTGGTAGAACCGCCATGTGCTGATCGACATCTTCAGCGAATAGCTCGCCGCGTTTATGACAATATA