Description :
From Genome Similarity Track
Location :
Scaffold_24:33179- 35309
Transcript NameFunction/comments
Pytul_var.sporangiiferummaker-pug3_contig_24-snap-gene-0.50Possible MAPK

Sequence
2130 bases(100 bases per row)
CGTCCGATTCATCTTCTTCTAGCAAAGACCCACGTGAGCTGGCTGCGAGCAGCAGCGCTTTGCAAGTGGGGTCCATCAAGAATAGAAGCCCGTCAAGATC
AGGTGACACGGAATTAAAGAGGTGCGCTATTCGTCGCCAACTCACAGACAGCTTTTCTCGCGGAAGATTCACCAGATAGGGATAAAACACTTTCACCAGG
TTGCTCACCCCCCATGAAGTACATCGAACGCTCTTTCTGTTGCTGTTGGAGTGCATCAGCTTCAGAAAGTCGACGGCGTTTCGCAAATGCACCCAAGTCG
TTAGGTGAAAGTCAATAAATGTCGCTTCTGTCAACTCGACTACTTCATCAATCTCGATTTCAGAAATGAGCGAGTTCCCACGCTCTAATGATTCCTGAGC
TTGACTGGCGAGGTAGTCGTAGACATTGTCCACTATGGACAGACATTCCCTGGACAAATAATCTTCCAGTTGTACTTCTTGTGCAACTTGAGATCGCAGC
AACTCTTGCGTTTCTTCTATCGTTGGCGAGAGCTGGTACTGACCCAGAGCCGCATAAAATGAGTTGAAAAGTGCTCGGTTGATGGGCTCGTGGTTAGCTA
GAGCATTCTTTGCAGTGCCATTATCTGTCCATGATAGGCACTCATCAATGCTGATGACGGGATCTTCCACAAAAGTACATCCTGCAGCTGAAGATGATTG
TTTCATTGCTTCGAGTAAACGGCGGGATAATGTGGCAGGCTCGTCTTCCTTGCCAACCTTTTCTTCTTCACCGACCTTTTCGTCATTGTCTGGCTCTTCT
TCTGTTGTGCCACATGCTTCTTCTTTGTCTAATTCGTCTTCCTTTTCAATAGCAGAGGTACCGTCCGAATCGTTTCGTGCTGATGACTGCAATTCAGCGC
TTTGCTGATTATCATCGTTTGGACCATCCAATTGATTGATTGTGCTCTCGTCGGACCCCACTATTTGCAATCTTTTTGCGACTTCCGGCTCGTTCTCGTG
GTTTTCTTTCTGTTTTCCCTCCAAGGGAGAAGAAACATTTTCCTCATCCTCATTATTGTCGTCCGTTTGTTGATTTTCGTCCTCTGTGTCAGCCTCTGCA
GCGTCCTCGAAGCTGTTATCGTATTCGGATGACGAGCGTACGTCCTCTCTCGCTGTTGTCATCGGTGACAACATTGCAGTTTCGCCACCTTGATCATCAA
AAGGTATGCTTGGCCTCACCAGGCCATTGAAACTTTCGTCCAAGATATGCACAAGTTCATCTGCTGCTAACGCGTCCACTTCATGACTAGATGGCAACGT
ACTTGCATCGTCTTCTCCTTCCTCGCTGGCATACTCGTCTTCTTGGTCCTGATCATCTCCTCGAGCAGTAGCATCACCTTCGCTCTCTGCTTCCTCACTT
TCTCCATCGCCACTATGCTGCAGTATCATCATATCTGCCCTCTCAGGTTCCGGTGGACGGAAAGCATCGAACCCAGCAAGGTCGTTCATTGAACCGCTTG
TCTTCTGAGCATCATACTCGGACTCATCACGATCACTGTCAACGGCATTCAGAATGTTCGAGTCTTCTGGATGCTTCTCAAACCCATGGTCCACTAGGGC
GACTGGTGACAGGCGTTTGCTACTAGTAGTCGCCATCTCTACCATCTCCGTGATGATTGCTTGCGCTGCCAGGACACGACCAAGCTTTTGGTTGGTTCGG
ATCAGCAAAGGATTTTGCTGCGTGTAGCACTCAAGGTAAACGCCTCGCGCTTCAAGTTCCGCTTGCGCAAAGTCCAAATCGTTGTACATCTTCAAGAAAT
AATTTCGTTCACGCCACAGAAACGGAGGAGGTTTCCTACAGAAAAAGACAAGAAGAACAGGTTAGCACACCGTATGTCCTTCTCATAATATTGTTCGTCT
CCGCAAAATGTCATGGTTCTTTCTGCGAACGTACTCGGCTTTAGCGCCCGCCTGAAGCATCCACTCCACGATCGCCTCTACGCACTGAATGCCCGCGAGC
TGGAGATCCTCGGCAAGTTTTTGGGCCAATTTTGTCGCTTCTCGAGAATTTGTCATTGCACCCGAGGTACCAGATCGACTTGATGGCGTCAGTGCAAGTG
CCATACCAGCCTTCGCTCTTATTCTTTGGA