Description :
From Genome Similarity Track
Location :
Scaffold_24:331779- 333611
Transcript NameFunction/comments
Physo_156636hypothetical protein

Sequence
1832 bases(100 bases per row)
CCGGTCGTATTGGATATACTGTCGTTGGTTGCTACTAGGCTTCAAGTGTTGATGGTCGAAGTAAAATACTGTATTCAATCAGCGGGCTGGCTACCGCACG
TCCAGACCTCCAAGCACTCAACATCGCGCTTCACTGTTGTGGTGTCGGTATAGGACTATACCGACACCACAACAGTGAAGCGGGCGATGTTACCCTGTCT
TGCGAATGGTTCGGGAACTGGTCACTCTGCACGCGTCACTACCATGGCACGGCGGATACGACGGGTGGAAATGAGCGAGTTAATGTGTCACCACGGCAAG
CTCCTGCCTTTCACGAAGGATAAACTTCCTGGCGAAGGCTGCGTTGTTCAGCATAGTTACGACCACTTCAAGAAGCCGATTCAACGCCTAGGCTCGTACA
GGTTGAGCCCAATATTTAACAAGCGCAAAACAATCGGTATAATACATATATTAGTCTAACATGTAAGCAGACAAAATTGACGAAGTCCGTCATGTTAACG
ATTTCAAATATTCGTTGCACCGGCCAGTATCGAAATGGGTCTCTGTACATCTTTATCCGCTGTATAATAGTGATATGACGAATCCGAAGGGATTGATGGC
AAACACTTAACTAAGCTACAAGAAAGATTTCACATTAAATTTTGTCAGTTGTGGGTCATGGCAACCCAGTGGGACTTCCTCGAACCGTGGCGAGATGCAT
TGCGCTCTAGCTTGGCTCTGAAAGAGAAGAGCCATTCGACCGCGTCGACTGTTAAAGTTTCGTTTGACTATCCGCATGCGTGTACCTCGTTAATGAGGCG
ACGAATGTACCTCAGACTCCAAGGCAACGAACGAGACCCAGCGGTGCTTCAATGACTTCGAGAGGCGATAGAACTGTTCACGCTGCCAGCGTTTGTAAAC
TATGAGGCGTTTAACGAGCTGATGGGTTCTTTGTCGGTAGCTACGACGGACAAACAAGTCGAGTACACCACCGAATGGGACTCCGGTTGGATCCCCTCCT
GCGCTCCCATCGCCTCTGGTTCCTCTGCTGCAGCCCCACCTCACTTCTTTCTGGTATACAGCGGGGTCATCAAGCGGCAGAGTCCCATCAAACTGGACCT
TGAGTAACAACGCCGTTCTTCTGACTTCGATGGCTGGGTCACGGATCACGGATACATTCAGCAGCTTGACGAACGCCTCCATGCCCACGAACGAGAGCCG
TTTCGACACTTCCATGACCTCCCGATCCAATTGCGCTTGTATCACTGGTGCGTAGTGCAGCTTGCTCAAGAAACTCCAGTCGGTTATGGTCTACATGTAT
GTCACTCGTTGAATCGTTGAAGTGGCGCCTTCCGTCCCGCAATAAGTGTCGTATCTTTCTCCAGCTCTCCCACCCCCGTAAGTCACCAACCTACAATGTT
GACACGCTACCGCAGCTCTCTGCACCACTTATTCTCGAACACAGCATATCCTCCAATCACATCCCTCTCTCACCGCATTATCCCCCAATCCCCACTCAGC
AAAAGAAACGTCGCAGCCTCCTCTTCCACATTCACAAGCCCCTGAGCAGCTCCGATAGATCGAGCAGGTCACACCCCAAGCTTCAGCCCCCACACTCCCG
GGCCCCTCTCTATCGCTCACACGACGCCATGGCGGACAGGGTTTTCTGGGCGCTCACGTGCTCGCTGCTGTCGCTCAGCGGCTGCGTCTTCCTCGTCCTC
GTGGGGGTGCTCGTGCACCTGCAGCCGCAGTACATGAAGCTCAGCAAGAGCGTCGAGGGCCCCGCGCCCATCTTCGAGTCCGCGTGCCTCTACGCCACGC
TCTTCCTCGTGTCCTCGGCCGTGTACTACAAG