Description :
From Genome Similarity Track
Location :
scaffold_54:33166- 38092
Transcript NameFunction/comments
Pl_110989hypothetical protein PHYSODRAFT_505033
Pl_110990hypothetical protein PHYSODRAFT_505018
Pl_110991Drug/Metabolite Transporter (DMT) Superfamily

Sequence
4926 bases(100 bases per row)
GAATGAGAGGGGCAAAGCGAAACCGAAGTAAGCATCGGTTTGTTTTCATGGCAATCATTATCCATGCAGCAGACTTGTCTGGTCAGGCATTGCCGTACAC
ACAGGCAGTCCGGTGGGGCATGCGTGTACTCTCCGAATATCAACAACAAGCAAAAAATGAAGCCGAACTCCACGTCCCTGTCGATTCGTTCATGACGAAC
CTTCACCACGCAAAGACCCGGGTCACCGTGCAGCTCAACTTCATCAACTACGTTTTGCGTCCCATATGGTTGCCACTGGCGTCGCTGTGTCCTGCCGTAC
GAGTGTACGCAGATTCACTGGAATCCAATCGGGAATGTTACAAGTCTGAGTTGGACAAACTTCAGCATGGATCTGCGGAGGTTGAAGAGATGACAAGAGT
TTACGTGCGTGGTTCCACTTCACGCAACCTTGTAGATCGTGCTCCTAGTCTATCTGACAATCAAAGTGATACTCCAAATTGACACAACAATAGAGTGGTT
AGAGGCAAATGAACATGTTGAGACCAAAGACAGCCCGGTTTTCCACCACCATCCGCTAGAATCAACCTCGGCGTGACAGCACTTGCGTGCTCTTCGTGCT
AACGATAGCAACAACGTTGCTCTGATCCATGAGCACGTCTTCAACTGCACGGGCGCGAGCATTCGAGAGCAAGTCGGATAGCAGGCTCTCTACTTCCTCC
TCGGCTTCACCAACCACCACAATATGCATCAGTGTGCCCCGAAGGAACTCAGCATCCAACTGAATTTGCTGTAGTCCGAACTTTGACAACTCCAACAACC
TCACCCATTCGCTAAAGGCCTTGATGCACATCTTGAGCATCGTCTGGACGAATGCATCTGCTGTTAACTCTAGCTGAGTCGGAAAGATATGAATTTTGCG
TGCGAATATTCGGTCCACATCTAACTGCATACCCGAACTTGCTGCGGTAACTCCTGCATTACGGGACCGTAACGCACTAGCACGCCGACGGAAATCGCGG
CTTGCTGTGCGACTGCTGTTTCCGATGAAAATGCTTTGTTCGTCACCAAGCGCCAGTGCAACTTCTTTTCCATAACGGAAAGTGGTCTCCACAACCGCAG
CCATCATTTCCTGTACACTTCTCGGTTCCTCATCCATATCAGCCCACGATGTAGCAGCTACTCCGTTATAGACAATGATACAGAGCTGGTTGCCATATTG
CTTTGCGACGTGCTGGAGCAACTCGGCAGAAGATTCGCGGGTCACTTCAATCATGTGCGTTACGTCTTGTTGGTTCATCCGACGGTGGCCGATCAACTCG
CCCTGGGAGCCTCTCGAAGGAGACAAAGGTGTTGGCAAGCATTCAATGAGACTGCGTACACACTCGCCGATTCCCTCAGTTGACAGCTCTTGACACATGC
ACGCCAGGAAGAGCAGGAACTGTGGAGTAGGTTCTAGCCACGGAAGTGCTACACTGTCTTGCTCCTCAACTCGAATTCCCCCAAGTGGTCCATCGTGAGT
AAATGCGCGCTTAGGCTCAGTATATTGGAGCACAGATGCATTAAACCACTTCAAGAAATCGTAGAATTGGCACTGGGAAATTTGCAGCAAGTAGCATGAA
AGTTAGACAACACACAACCCCATGACCGAATGCAAGCAAATAACTCAATGTGCATATTACCTGGACCAAATCAGAGAATAGTTGACTAAGCTCCGGGAGG
ATTGCAAAGCCTGTTTGAACCATTGGCTCCATTTGCTGTAGCACCTTCTGCATCATGTCGGTAAACGCAATCGCCGACTGTTGTGCTAGAGGTTGAACGC
TCTGTCCACCATCGCGCGAGCTTCGCCCCAAGCCAGACACATCCTCATGAGAAGTGACAAAGAGCTCCCCAGTGTCCTCACGCAGCTTTTGGAATACACC
TTCGATCTGGAAGCGCACACAGTTTTCCACAATTTCAGTGGCACTTGTAGCCAGACTGCACATCGGAATCATTTTATCCACATTTTTCACTTGAGAAACA
AAGTACTTCATCACGCGCATGAAGACAAAGTATTCGCTTTCGACAACTTCCACCGAGAGGTCATCATCTTGTAGCACATCGAGGACTTCGTTCGTTGATC
CCTGCAAGCACAAAAAAGTGATGATGGAGTTAATACTGTGTGAACCACTAGCTGTAGTATTACCACATAGCCGACAAACTTACAAACTCCGTGTGCTGGC
GACGAAACTGAGCAATGCATTCACTCAAATACAGTCCAAATAGCTCTTTCACAAAGCTGAGGAACAGATCATCTCGAATCGCATCAGAGGACTTTCGTGA
TGCTGACGATCTCTCACGCGCGACGACCTCAGGCATAAAGTGAGTTTTGTATACTGAGAATACTCGGACCATTTTGGTCAAGACATCCGTGTTGAACCTT
TGCAGGAAATCAAGCACAGAGTCGACCTTGCCTTGACACTGTAGCGGGAACGTTAACGGTACGATAAGTCGATGTGCATTCGGAAATCAAAGTAGCATAA
AGCTGTTGCAACACGACAAGGAAGCATACCTTAAACACTGCAACTGCACGCTCGAAGTATACCTGATGCCACTCAAGAAATTGGTCCCGAATCTCGTCGT
TGCAGGCATCTAACTGATGCAAAAGTACCACCGTCTCGCAGAGCTAGCCGCATCAAACAAGTCAACTCAATTGACACTCATTCACCCAAAAGCAAACGGT
AGCAATACCTCCTCTGACTCTAGTGTTGTATCAAGCATCCGTTTCTTGAGCAGACGTTCAAGTTGCTGCATAATCTTCTCGGCTTCCAATTGAATCGTCT
ACCAAACCAGAACATCAGAAACACAACACACCGAAACTCAAAATCAACTCACCTTAAACGATGAGATATGTTCATATCTCCCCAAAATCCGGCGCGCAAG
TAAATAGTACTTGGTCGCATTAGCGTACTCCTTCTGCTTCACCGCACTGCATCTCACTGTCAATTCCTTATCCAAGTAACAAAACCCCCTCACCGCACGT
ACGTGTTGAGTCTCTGCGGGAGCTCGAAAATGAACTCGAATCTCTTCAATAGTCTCCGAACACCAATGAGTTTCTCCACTTTAGAGCGATGCGGTGCCAA
CGCCACGTTGATGCTCTCGCTCTTGGCCGTGATAGTATCCATACTCTTGACCACACGCCCCACCTCGTCCTCCATGCTCGCCACATTATTCTAGGTCAAA
ATAGCCAAAAGTTGTCAATAAAACTGAGACTTTCAGCAGCATTTCCCTCGAATTTCTCACTTTCATCTTGCGGATCGTGTCCGTGGCACTGATAAACTTG
TTGTAGTTCTCATACACCAGCATCTGCATGTTGGTGTCCAGCTCTTTAATCTCGCGGATCAGTTGGTCATCCGTTGTGAGTAGATCATTCAGGCCTTTGG
TCTTCAGCAGATCCTACAGGTAGTTATGAAGAGGGTTACACTGGGGTTACACGTCGTTTACAGTCATCTAGACGCACCTTGACGTAGATCTTGGGGTCGA
AACCGGGCGAGTCGATATTGCGCAGCTGCTCCTGTCTGCTCTCTTGGTCCTGCAGCCCGTAGTAGCTGCTCAGTAGCTCCTGCATGCGCGACATTCCCTG
GCTCTCCATGGCGATCTTGACTAAAGTCTTCCCAATTAGCAACAATTGAAAATATTGTGATCTGATTGGATAATTTTTAATTTGGGAAAGGTAGTACTCT
ACCATGGTAGTACAAACTACTGCCGATCACCGAAATCTTCCATTTGGCCAATCAGGTTCATTTTGCGATCCTCTTCATCTTTTGGAGCTACAATGGACGT
GAAGCGGCTACTGTGGGAGTCCAAGCTAGCGGTGGCGCTGTGTCTACTCATCATGGCGCGTTGTGTGGACCGCGTGCTCTACACGTACGTAGTGTTCTTT
GTTCTACCAAAGTGGTGGCTGTGGAATTGACCCCGTATCTTGTGACTGTAGACGAATCACATATGACTACACGGAGTTCCTCTGGTACTTTACGAACGTG
ATCCTCCCCATCGCTTTCTTAGTATCGTCAGCTCCAGTAGTGGCGTACGTCGTTGTGTACTATGCAGTAGTGGTAGTATCCATTGTGGTGCTAAGGTCTG
TGTGTATTGTACAACAGCTACAAGATCTACTTTACAGGTAGAGCGGTTCTTGTGTCTTTATGTTATTCTCTTCATTGCTGACACTAGAGCTGCTGCTATA
GATGACATTACGCAGGAGATGCGTGAGTTCCCCCATTACAAGTACATGCTCATGGCGCTATTCGACACGCTCTATAATCTACTTGGCGCGTTCCCTACGC
CTCACATCGGGTCTGTCAATTGTGTTGACCTATATAACAATTGATACTGGGAGACTTAGTCTTGCTTTTGATGCTGACAGAGGGAACATGGCCAATGTGC
TGAACCAGCTCAACCTCCCGTTCAACATGTTTCTGTCGTACATCTTTCTACAAACACGCTTCAAACGTGGCCACATTTTGGGCTCTATTTTGGTGTTGTA
TGGCGGTATGGTGAACTTGATCCCAGCTCTTACGGGTCAGGATAACGCCAATACTCCTGATCCAAGTGTGGGGTGGATCACGCTCTACATTGTGTCACTG
GTGCCGGCGGCGGCGTCGAACGTCTACAAGGAAATTGGACTCAAAGATGTGGATTTGGATATCTGGTACGCCAATATTTGGATCAGCTTCTACCAGCTGA
TCATTGGCTTCGCTACGATCTGGACCGTGCGGATTAGAGCGTTCAGTGATCCACCTGTGCCCTGGGCTGATTTCCCGTCCTACGTGTGGAAGGCTCACGA
GTGCTTCATCGGAAACGAAGTTGAATTGAATGGTAAGGACTTGCCGTGTGACTCAGGAGTGATGACCGTGTTCCTGGTTTTCATCGTGTTTAACACAATG
TACAATCAGCTCATGTTGTACATCTT