Description :
From Genome Similarity Track
Location :
Scaffold_16:331642- 340362
Transcript NameFunction/comments
Phyra_94402glucokinase putative
Phyra_76154RNA polymerase II-associated factor 1
Phyra_76155Hypothetical protein
Phyra_76156Hypothetical protein

Sequence
8720 bases(100 bases per row)
AAGGCGACGAGCTCTGCAAGCATCTGATTGAAGAAGTAAAGTATGGCTGTGGCACCGCCTTATGGTTTGACTTACTAAGTGATGCGAAACTAATTGTACA
GGCTGCCGACTACTTGGGTTTTGCCTGCGTGACCTTCTGCCGAATGTTAGACCCGGAGGTAAGGATGTTCAGAGCCATGGAGACAGTACTGCAGAGATAA
CCCTGTTTCCTTGATTGTGGCAGATTATTGTTCTGTCAGGGGGAATTGCCGAGGCTGGAGAGACCTATGTTGAGCAAATTCGTCGTGCCTACGCGAAGCA
CACGTGGACTAAATTCCCCAACCCGGTACGCTTGGGCTTCTCGTTCCAATATCTGTTTCGATGATGTCTAACTCGTGTTTTATGTTATGTGTATAGGTTC
GTATTGAAAAAGCGAGCGCGGGGTATGATTCGGGCATCATTGGTGCCGTTGCGGTATGCAAAAATCAACGCAAATGGCAGTGAAGCTTCGTACGGTGTCG
TATGCAGGCAGATGAGTAAGAAGTCCCAGAAGATTCCAGCTTCAGATATCGATGATAGTTGAATGAAGTCTCTGTTTGATGTAATGCTGGGTTTATTTGA
TGATCGCGGAGCGGCAAGAAACAAATCACTTTCAGGTAGTGTGTATCGAAGGAGATGCCGCATTTCCTATCTGTCCTGAAGGAGCAGCTAACAATTGCCA
ATCAAGCTAGTCACTGTCGCTGTCGCTGATGACGGGGCTGGCATTACCGTCGTTGTGTAGAACGGGGCTATCACTGCCATCGTTTTTGCCGCCAGCGGGG
CTGTTCGAGATCTCCGGTGAGCTTTCAGGGGGAGGTGTGTTTGCCTTGTTTTCCTCGTCAACAGAAACAGGCGATGATCGCTTCTCTCCTGCCCGTCGGC
GCTTGAACTCGCGCACACTCTCATCGTCATCAAGCTGGTCGTCATAGACTCCTCCGCACTCGAATAGGTCCTGGGTACGACGGTCTGTTTCGACTTCTGA
GTAATCCCGACGGTAGACAACAGCTCCGTGGCGACGTTTTTCCTCTCCAGTCATCTGCATACAGGAAAGCAGGTAATCGTCAGAACAGCAGCGACGCGAG
CCCCAAGAGCATGAACGCACATACCTTCGTCTTCCTCAGCTGGATGCGGTTCAGAACGTCACTGTATGTGAAATGGTCGGACTCCGGGTCTAGCATGAAC
ATAACATGTTGTGACTCCCTCTGAGGCAGCGAACACCAATAAACAGAAATAAATCAAAGTGAGCACAACAATTTCAGCTGAAACAGAATCAAAATCGCCA
ACGTACGCTATCAAGCGACTCCACCGCCATAAGATACTCGCGGAGGTACGAGAATTTCTCGCGATCGCTACTGTCCTGTGGTAGAAGAAACAATTCACCC
ATTAGCTTGTGCCGCGGTGCTTTAGTGCATACATAACAGGGGTGTACCTCTTCTTCTGCCGATCCGTTGGGCAGCAGGATAGAGCCCTGAATAAGCTCCT
TGCCAGCTTGGGTCTTCTTGTTTACGCCGCACAGCAGTGCACGATCCTCGCGGCTTGTGATTCCCTTGCTCTTGACATCTTCGGAAGGAAGAATATCGTA
CGACTGCAAGTCCACAGAAATTAGTATCCTGTCAGCTTGTGTCATAACGCATACCGAAATTCCGCTGCGAGCAGACGTACCAGAATTGCATACTTGTTGG
CAGACAAGAGCTGATCGGGGAAGACATCCCACACCTTGGCGATTTTTTTCCTTTTGCTGTGCGGGTGCACCAACAACTTTGGATCGTTAATGTCGCGGAA
GGACGCTTCGGCACGGTCCTCTAACGTCACGGACACAACCTCGGCCAGCGCATTCTCCGTGCCCTCACGCAGTGCACTCTGAATTTCTGCCTCGCTCTTG
AACTTGTGCACGGAATCGTACAGATCGTTGCCCATGTACTCCGTGCGTCGCAGCCAGGAGACTGTGGGGCGCACCTTAGATCGGCCCTTGGTGCCCATAT
GGTCCTCCTTCATCATCAGCGCCTGCTCATCGCCAACCTCCAGCGGCTCGGGGTCCGTCGGGGCTGCAAAAATCCATCCGCGACATTTTAGCACAAAATT
CTACATCCTAATCCCCCAGATAAGAGTTCTACCTTCATATTTGGCCGGATCGATGAGGTCGATGGTCAGTCCGAGGTTCGGCTCCTCGTGGATCTCGTAC
GTGTAGTCCATCTCGAGTGTGTTGGGCTTGTACTTGATGAGTCTGTGCACATAAACCACCACCACATCATCAGCTTCTCCACCTTTCTCCCATTCTGCAG
CTCGCCACTGTCGCACCGTTCCGGCTCGTGCGGGTATTTGACAAACTTGGTGTCAAACGGGATGTCCGGCAGCGAGTTGCGGAACTCGAGGCTGGCCAAG
AACTCCGACTGCTTGCCCAGCAACGCGCGTCGCTTGGCTTGCGCGTGGCTCTCCAGGATCATGCGTGTGTGGTCGCGCCGCGCTTTGAGTTTGTCCTCCT
TGTACTTGGCCACCTTCTTGCGCTCCAGCTCATAACGCGCACGTTCCTCGGGTGTGGCATTGGCACCGGGGGGCGCCCGCCTTTTCCGCGCCTCGTCCTC
CTCGCGACTGCGGCCGTTGCTTTTGCTAGCCGCCGCGCCGTTGGCCTCCGTCGCTGTCTTCACCTCCGCCATCGCTCGAAGCTCTTTTTGCTCACTCCCC
CTAAACCGAGAAATGTGGTGGAGTCTAATTTACGTGGTGCACATCATCATATTTTTGTCACTTCAAACGGCGTTTCGCGCAACAAATGGGCTGTAGCCGA
CTCGCCTATTAGCCATGAAGCAGCTGCTGATCCTGGTGGCGCAGCACCCGCTCAAGGTCGGGTCCGTGGTGCTGCTGCTCAGCGCCTTCTACAGCTTCGC
GCGCGTCCTGGTACTACAGTACGTTGTGGGCTCCGTCCAGGACGCCATCGTGCGCTACCCGAAGAACTTCCCGCACGCGTTCTTCCTCCCGCTTTTCCAC
GTGTCGCTGGCGGTGGCTGCTGCTGCTGCATTGTATCAGGACTATTGCTACAATCGCTTCTGGAGCTCCTCCACACCCACGCAGCTCTGGAAGCACGTGC
TGCCCCTGCCGCTCACACTGCACCCCGGCAAGTGGAGTCGGTTGGTTGGCATCCCTTTGTACGCGTTCGGCATTGCAGTTTTGGAGGCTGTGCTTGTGTT
CAGGGACCCTACCATAGAGAGTGTGGCCAAAATGGTCACTAGAGTTTTGTTGCAGCCGCCTCGAGAGGAGGGGCAGGTACTCATGCCAAAACACGTTGCA
GGCGTGCTTTTTCAGGATCAAGCGGAGGTGGCCTGGAAAATACTTACAGGAGGTGCAGCAGCTCAGAAGTCATCGACGCGTACGTTTTCGTACGTACGAC
TGCTCGTTGAGATCTTGTTGGCTGCGGCAGTTTGTGTAAGCTTCGCTCTTGCGCGGTTCTTTCGAGAGCCTCAACACGGTACGTTGCCGCTGCTATTGCT
GGGTTAGTTTCTGTATAACTTACGCCTTGCGTAAATACTTGTTGCATTGGAGTGATTAGATGGGGATGAACTGCGCGAAGCTGCGAGAAACAATGACATT
CTAGGAGTGAAGCTACTTCTTGCTCGGGGGATGGACCCGGATGCTTGCTCTGGTGATGGCACGACGGCATTGCACGTCTGTGGGCAGCAAGCAATTGACA
GGGCCGCGCAGGTTCTTCTTGAGCACGGGGCAGACGCGAACGTAGCTGATCGACTTGGATTTACGCCACTACATTGGGCTGTACAAATGCGACGAGAAGA
AGTGTCGACTTCAAGCCGTTTGGCGACGATTCGAATACTGCTGCACCATTGCGCTGACCCACGCAAACCCGACTCAAACGGCACAACGCCGTTAGTAATT
GCATCACGAAAGGAGAACGAAGCATCGTTGGGAGTGCTAAAGGAGTTCTTGCCTGAAGGTGAAACTGGTGGAGAGGTAGAAACCACCGAAACGATAGACA
ACGCCAGCGTGGACTTGGCAATTCCGAATAATTAGCAAAATTACCACTCATCGACTACTAAATCCCGTGACGTCCATCTCTATTACCTACCGTTGGCACC
ACAATCATAAGGTCTGCGTTAGTTCAATGTAACCCAAACGCACGATGCCAAAGCACGTACCATTGACAAAATCCTCTCTAGCTCTGCCTTAGAAGGATAG
AGTGGTAGATCCAGCCTGAACCAGCAAGGCAGTGGTCAACAAAGCGGCTTGCAGAAACACGGTTCAAAATATGCACTCACCTGTTCAAGCACGTACTTGC
ATGCGGTAGTACGGTGTACACGGTTGAAATATCCTTCCCAAGCTGGATTGTGAAAAGTTGGATCTCGCCATCCATACCAGTCAGACCCTGTATATTGAAG
GTCAGAACCAAATTCACTTAACGCGTAGTGAAGCCGAAAAATATACCTTAAAGCCTTCGACAGGAACGCCGCTGGAACCAGTGACGTACTGCAGCAATCT
TCCGCGTTGATCTTGCGTGAACGACTCTAGAATTTCCCAAAACCAGGCAACCAATTCAAACTCGTGACTACTTTGTTCGTAGAATCGAATATCTGTGTGC
TGTCTCCAGTCATTGACATCGATTTGAGGTAATCCAGAGAAGAGTATGTCAAGTTCCTTGAAATCAAATACGTGAAGAACTGAATCGCTGATGACACTGC
GCAGACCCTCCATGATGCTCGAAATTTCCGCTCGAACACTGTCAAACAGATAGTACTGTGCCACTTTTGCAACGTAAAGCTGTTTGTTTCCATCGTGAAG
AATGACATCGGCGCCATTTGGAATAAGTTCTGCGCCATCCACCGTGAAGTTCAAGCCGAGAGCATTTGTGTTATCGTTTTCGAGGATCCACATCATACTG
GAATGCACCGTTTCATCGAGCAGATATAGGTCTGAGAGCTTGAGTGGCACGCCGAGAATGTGCTTCAGCAAAGGGACGGAAAGCCGCACGTTTAGAAGTA
GGCCTTCAAGCAAAGCCTTCCCCAATAGCTTTCCGAAGAAGACGTACATCTGTTATTATGAGCATCAACCACAGTTAAAACAATTTGTGATGAGCAAAGA
GGCAATGCTTTGGACATACCTGCAGCTGCTTCGTGCATTTCCCCGTCGCAGTTCGATTAATCCAGTATCCCTGGTGCGCTGCTGAGCTGGTTAGTGTGAA
CAGCCCCAGAGATTCCGCAAAAAGCTGGCTGCAAACAAGATGCAGCCACTCCCGCAAAATGCCACCACCATCGACGCCAACCTCATCCATAAAATCGACG
CGTAGTCGGCGATGTAGAGTTGCATCCGGTGCAGACATAAAGAGAGTCATTGACTGCTTCAACACCCTGTCACGATGAATGCCTGCAGCTTTCGTCAGTT
GAGCAACCTGAAAATCACAGCCACAGCTAACGTACGTATAGTATGGTAGCCATCGACAATGGACGAGCAGAGCTTGAGCGAATACTGGTAGAACCACTGT
GCTTTCTCGGAAAATGGCAAGGTCGATACTCGCTAAGAGAACCGCGCACAAAAACATTAGACAAGAGTGATAAGGCTTACCCGACCGACTGGCTTACCAT
GATCGTTTTGGAGTATGGTCGTGATGAAGTTGAAAATTCCTCGGCTAAGCGCCAGCGCACAGTTCGGCTTCCCGAGTGTGAGTCATCTCGCACGAATGCA
GTTCCTGGGGTGAGCCAAGAAAGTTGTTTCCCACTGCTGTCCGAAAAGATGACAGAGGAAACAGACATCCTCGAGGACCCAGGCACCTGTGGAGGGTGTT
GTATTTCCCATTCCTGAAAGTCACGCTCTCTAATAATGACGCTGCATAAAGCCTTACTCACTTGGAGAGCTTCAAAAGGAACGTTTACCTGTAAGACCCA
GAGTGCATAACATTAGCTATACAGATCATTATCGGATCCGAAACTTTTCACCCCTTACCCAGCGCACATGTTGCCCTCCAATACAGCGCTTCCACTGATG
CCGTTCGCGTGCAATTAACTGACGGTCCGTCAAATCTTCACTAGGAAGAGCGTTCAGACCTCGAATCCAGGCAGCACGAGGAGAGGACATGAGGAGATAG
TTTGAGGCCGAACGCTGGCTGATTTCACCTTGGGGAGCGCTCAGTATGGAAGCACTCGCATCTTCCTGTCGACTTCTGATCATCTTTAGCTCTGCAATCC
ACGAATCCAGCACATCAGATCACAGATAAACCATGAAAAACAAATTCCAGCTTTTTCAAACCTTCAGCCGTAGTACCGCACAACACGCAGTCGGTCTGCG
AAAACTCGTTTGTGTGGTAGCAGATCTCGCATCTCCATCCAGCATTTCTACAAAAATGCCACGACACCGGAAAGATATAAATCCCCGATCTCACTTGATC
CCCAACGTTCAAAAAGACTCACGATCGTTCGATGAAGGCGCGGTGGCGCGACCGCCGGCTCGAGCTCGTGCAGCACTCCTTACAGGCTTTCCACGTCAAG
CATAGTGTGACAAGCACGAGGCCCACGCCAATGCTGACGCCGATGATCACCGTCTTCGAGCCGCTGCTTCCGTCGGAGCTGTCCTCATCATCGTTGTAGC
CGTAGCTCCCGTCTGTCCAACATGAGTCCATGCCATCAGCACCAATCTCACCTCACTAGCTCTCACATTGCACCGTACAGTGGTAGTCGTAGTCACCGGT
CGTGTTCGAGTAGGTGCCGTCCAGAATGGGCATCAAGCCGCGCAAATCCACGCTCTCCTCATGTTGCGTGGCTCTCCTCAGTTGGGGCTCGGCGCCTGCG
TCCATTGCAGCTGCTGCACCATTCAGTAAACCCAGCCAGGTGGCGACAATGACGAGCGACGCCAAGGTCCACAGTCGCCTCGCCATCGCTGCGACTGCAG
CAACGTCTGTTGCTCCTCTTCGGCGACTCGTTCCGGCCGCTCTCCGACCGCGTGTCAAGCTTCCTGCGGCGTCCTCTGCTGGTGCATCGACGACCTGCTT
GCGCATGTACAGTCGACTTGCTGATTGCAGAAATGGAGTGACGAGCTTTCGGCCAATCGCGTTTCATACAAAAATCAAGTGATAACGATTCGGATTTTCA
CGGAACTGTAAGTCCGCCGCTCACACGTTGGACTCAGACAAATCCCGGCGGCAACCGTATCGACACCAAGCATCTCTACACAACACCAAAATAATATTTA
CAGCTTTTTATTCCTCTTTGTGACCTCGCAATGGGCCTCGCCTCCTCCTTCAGAGTCGCCGCCGTGCTGGTCGAACTGCGTTTATAATTTGAACAGACGA
ACGCCGTCGGCCGTCGGGATGTTGCTGCCTCCGCTGCGGCGGCCCGGCAACGGCCCACAGCGTCCGTCTCATTCACTCACTCTCACATACATGGAAGCTC
CATCTCCTCTTCTCCCTTGGTAGCCACTGGCTCGACGAATTCATTCTTCACACGAGCGCGGCAGCATCCGACCTTCTCTCCCGTGTTGCAGTCTCTCCTT
CGGTCGGAGAGTGCATTGGGGCTGGGCAGCCTAGTAGGCCTGGCAGAACTTGCGCAAGCACCCCATCGTGGAAAGCACTGGGTCCGAGCGCACGATGTCG
ATGAACGTCTGCAGGCGGGCGCGGCGGGCGTTGAGCACATGGTCCGTGAGCTCAGGCTGCACGAAAAGCACAGCGCCGCTCGACACGTGCGGCACTTTCA
CTCCGCGCGACGCCTTTTTCGCCTTGACCTCCTTCTTCAGCTCGCGCTCGAGTTGCTTGAACTCGTCAAAGGTTGCAGTCACGTCCCACATGACCACGGG
GTTCATGTGCTTCTCCTGGCCGGCCGACTGGGCACCGCAGTCCACGCGCATGACGTAGACGTCGCGGGGTTTGCGCTTGCCGGGGACCGCCTGCACGAAC
GCCTTGCCCACACGAATGTTCGCTTCGCCTAGGTTCATGTCGACGCGGCGGCGCATGTCACCGGGCACCACATTGACCAGGAGGCGATTCTTGTTCAGGT
GCGCCAGCACACGACGTCGGGCAGCCGGGGCCTGCCGCTCCTTTCTCTTGGAAGCGGCCGCATCGTCTGTCTTGTCGACATGGGTGGACTTGGACGCAAT
AAACCCGCCGTCAACGCGGAGCAATGGGAGCGTGGAGGCTGTAGCAGTCACCGGCTTGGCGATGTAGTAGTTTTGAACGGAGGCCGCGTTGCGTGAGGCA
TTCATGGACAGCATGGCGCAGCCCATGAAGGTGTAAAAGCTGATGAGCCCGAACGCCGCCCCCTGCACCAGGAGCGTGAGCACGAACGCGAGGACGTTCC
AGGCCAGTACGCAGGCGACATAGGTGGCGAGCAAGAGCGACGCGGCCGAGCTGAGGGTGACGTCGAGGTGCACGAGCGAGTCGTAGGCGCTCGTGAGCAC
GGCGAGGCGGACGCCCGGCAGGTTGAGCACGATCGTGGGCTTGGCATTGTCGGAGCTCACGGCGCGGGCGCGGGTCTTCATGCTGTCTGTTGGTGGCATG
GTGGCCTCGAGGGTCTTCGCAATGGCGCGAAGGAGTCGTACGTTCAGCGCTCGCAACTGAGCCCGAACGTTGGCGCTGGCAGGCAAATGTGGGTCACAGC
AGGAGGCTCGGAACGCTGCTGTGGCGTGGGATTCTTCTGCGTCTGGAGCTGCGCGAACTGGCTGCGTCTCCTTCCGCCCTGTTGATGGCTCTCCTGGGCA
CTGGCCTGTTTTTTTCGGAG