Description :
From Genome Similarity Track
Location :
Scaffold_7:33151- 36945
Transcript NameFunction/comments
Physo_387681Hypothetical protein

Sequence
3794 bases(100 bases per row)
GGTAAAAGATGAGAACTGCTATTTTTGTTTTATGTTTCTGACTTCCTCTAAATGTAATATTCTAAACTAGGAATCTGCCAACGGCTGGTTGGCAGGATTC
TGCTAACATGCAAGTCACTCATTGGCTAAAAGATGCTGCTTTCAGCCAATAGGAATCCTAAATGTGTATGGACCACCCGACGTGGTGGTCATAAATGTAT
GTAGCCATTGGTGTGCCTTACACCAAGGTCGAGGAAGTGTTCGAACCTCTAGCAGACATCGCATCTGTTAGAGTAACAAGTGACTGTAGCCACTTGTGCG
TGTAACCCCGTTACAGGTTCGGCGTAGCGGTCATCGAACCGACCTCGTGCATCGGGGGGTGCGGTGGAAAGCTGCGAGGCGAGCTTTGGACTGGGTGGTG
CGATCTGGAGCGGCTGTCCAGCTGTACGCAGGGCATAAAGCGGCGGCATTGCGGGCCGTCGCAAGCAGGCATGTAGGTAGGCGTGCAAGAGGAGGTGAGT
CGAACAAAGGGTTGGACACACCGGGGATTGAACCCGGGGCCTTCCGCTTGCAAAGCGGACGCGCTACCACTGCGCTATGCGCCCAGCAAAATGGAAAACC
TAACCTCCATTTTTCGGACCGCTTTGTCCTCGCCCCTGCGCGCGCTACGCACACAAACGCACCGCACGCGCACTGCCACGGACACACGCTACGCCCTGTT
GCCCGCCAATCGCATTCAAACGGCCTCCCCGAGCGACACCATCACCGACCCGCAACCGACGTGCTCTTCGCTGAAACGCGCTGTTCGTCGTGGCCACACA
CCCGAGTTTGCGCCGGATCCACGCTTCAGCCAGCGGCCAGGCCGTCTGGAGTGGCAGCGCCAACGCATTGCTGCTGGTTCTGTAATGGGCCTACCTTGGC
TCACTACTACGGCTTACACGTATGCGCACGTGTATGAGGAAGCGTAGGTTTCTTTTACTTGAGTTAAGTATACTCGAGATCCACGAGTATACTTTAAACA
AGATAAAGACTCCAAGTAGCGGGTTTTGGTAAAAGATGAGAACTGCTATTTTTGTTTTATGTTTCTGACTTCCTCTAAATGTAATATTCTAAACTAGGAA
TCTGCCAACGGCTGGTTGGCAGGATTCTGCTAACATGCAAGTCACTCATTGGCTAAAAGATGCTGCTTTCAGCCAATAGGAATCCTAAATGTGTATGGAC
CACCCGACGTGGTGGTCATAAATGTATGTAGCCATTGGTGTGCCTTACACCAAGGTCGAGGAAGTGTTCGAACCTCTAGCAGACATCGCATCTGTTAGAG
TAACAAGTGACTGTAGCCACTTGTGCGTGTAACCCCGTTACAGGTTCGGCGTAGCGGTCATCGAACCGACCTCGTGCATCGGGGGGTGCGGTGGAAAGCT
GCGAGGCGAGCTTTGGACTGGGTGGTGCGATCTGGAGCGGCTATCCAGCTGTACGCAGGGCATAAAGCGGCGGCATTGCGGGCCGTCGCAAGCAGGCATG
TAGGTAGGCGTGCAAGAGGAGGTGAGTCGAACAAAGGGTTGGACACACCGGGGATTGAACCCGGGGCCTTCCGCTTGCAAAGCGGACGCGCTACCACTGC
GCTATGCGCCCAGCAAAATGGAAAACCTAACCTCCATTTTTCGGACCGCTTTGTCCTCGCCCCTGCGCGCGCTACGCACACAAACGCACCGCACGCGCAC
TGCCACGGACACACGCTACGCCCTGTTGCCCGCCAATCGCATTCAAACGGCCTCCCCGAGCGACACCATCACCGACCCGCAACCGACGTGCTCTTCGCTG
AAACGCGTTGTTCGTCGTGGCCACACACCCGAGTTTGCGCCGGATCCACGCTTCAGCCAGCGGCCAGGCCGTCTGGAGTGGCAGCGCCAACGCATTGCTG
CTGGTTCTGTAATGGGCCTACCTTGGCTCACTACTACGGCTTACACGTATGCGCACGTGTATGAGGAAGCGTAGGTTTCTTTTACTTGAGTTAAGTATAC
TCGAGATCCACGAGTATACTTTAAACAAGATAAAGACTCCAAGTAGCGGGTTTTGGTAAAAGATGAGAACTGCTATTTTTGTTTTATGTTTCTGACTTCC
TCTAAATGTAATATTCTAAACTAGGAATCTGCCAACGGCTGGTTGGCAGGATTCTGCTAACATGCAAGTCACTCATTGGCTAAAAGATGCTGCTTTCAGC
CAATAGGAATCCTAAATGTGTATGGACCACCCGACGTGGTGGTCATAAATGTATGTAGCCATTGGTGTGCCTTACACCAAGGTCGAGGAAGTGTTCGAAC
CTCTAGCAGACATCGCATCTGTTAGAGTAACAAGTGACTGTAGCCACTTGTGCGTGTAACCCCGTTACAGGTTCGGCGTAGCGGTCATCGAACCGACCTC
GTGCATCGGGGGGTGCGGTGGAAAGCTGCGAGGCGAGCTTTGGACTGGGTGGTGCGATCTGGAGCGGCTATCCAGCTGTACGCAGGGCATAAAGCGGCGG
CATTGCGGGCCGTCGCAAGCAGGCATGTAGGTAGGCGTGCAAGAGGAGGTGAGTCGAACAAAGGGTTGGACACACCGGGGATTGAACCCGGGGCCTTCCG
CTTGCAAAGCGGACGCGCTACCACTGCGCTATGCGCCCAGCAAAATGGAAAACCTAACCTCCATTTTTCGGACCGCTTTGTCCTCGCCCCTGCGCGCGCT
ACGCACACAAACGCACCGCACGCGCACTGCCACGGACACACGCTTCGCCCTGTTGCCCGCCAATCGCATTCAAACGGCCTCCCCGAGCGACACCATCACC
GACCCGCAACCGACGTGCTCTTCGCTGAAACGCGCTGTTCGTCGTGGCCACACACCCGAGTTTGCGCCGGATCCACGCTTCAGCCAGCGGCCAGGCCGTC
TGGAGTGGCAGCGCCAACGCATTGCTGCTGGTTCGGCGTAGCGGTCATCGAACCGACCTCGTGCATCGGGGGGTGCGGTGGAAAGCTGCGAGGCGAGCTT
TGGACTGGGTGGTGCGATCTGGAGCGGCTATCCAGCTGTACGCAGGGCATAAAGCGGCGGCATTGCGGGCCGTCGCAAGCAGGCATGTAGGTAGGCGTGC
AAGAGGAGGTGAGTCGAACAAAGGGTTGGACACACCGGGGATTGAACCCGGGGCCTTCCGCTTGCAAAGCGGACGCGCTACCACTGCGCTATGCGCCCAG
CAAAATGGAAAACCTAACCTCCATTTTTCGGACCGCTTTGTCCTCGCCCCTGCGCGCGCTACGCACACAAACGCACCGCACGCGCACTGCCACGGACACA
CGCTACGCCCTGTTGCCCGCCAATCGCATTCAAACGGCCTCCCCGAGCGACACCATCACCGACCCGCAACCGACGTGCTCTTCGCTGAAACGCGCTGTTC
GTCGTGGCCACACACCCGAGTTTGCGCCGGATCCACGCTTCAGCCAGCGGCCAGGCCGTCTGGAGTGGCAGCGCCAACGCATTGCTGCTGGTTCGGCGTA
GCGGTCATCGAACCGACCTCGTGCATCGGGGGGTGCGGTGGAAAGCTGCGAGGCGAGCTTTGGACTGGGTGGTGCGATCTGGAGCGGCTATCCAGCTGTA
CGCAGGGCATAAAGCGGCGGCATTGCGGGCCGTCGCAAGCAGGCATGTAGGTAGGCGTGCAAGAGGAGGTGAGTCGAACAAAGGGTTGGACACACCGGGG
ATTGAACCCGGGGCCTTCCGCTTGCAAAGCGGACGCGCTACCACTGCGCTATGCGCCCAGCAAAATGGAAAACCTAACCTCCATTTTTTGGACC