Description :
From Genome Similarity Track
Location :
Scaffold_438:3315- 4528
Sequence
1213 bases(100 bases per row)
GTTGCTCGGTATAGGGCTACTGTAAAGGGGTTACACATCGTAGGGTACTCGGTACCCTGTGTCTTAGACGCATGGGATGGTATCCCATTGAAAGAGATAG
AATATCTTATCCATTTATAGGGGCTGACGGGTATGAGCCACGAGATAGGAAAGATCTCGAAAGTTCTTGGTTTAGGACATGAGTGCCTAGATTAGGTAAT
ATTAGGATTAAGATATTCTATAGAGGTAAACGTAAATAAAGTTCAGTCCCCCTTTTGATCTTGTCTAAGACACGTGCCTTGCGAGGCGTCTCGGATCGTT
AAGAGTTAGCACATCTCGCTGAGATAGCTACTCTTGAGCATTAAGTGCTGTAGATTCACTGAATCGTTCGGTTCCCTGGAACAGGGACCTTAAGCGTTAC
GCTTGTTGACTCATATAGTTTAGTTCTTTGTAACTAATTTTGCTCCTTGAGCACTATGTCTTCCTCTGACTTAAGGAGCTGTGCAGCTCCGCTACACTTG
GTAGCACTTGTATTCAATCTACGCCTGAGTCTTTAAATACTGATCCTCTGTGAGGATGGAAAACCCCACTCCCCTCTCTGAGGCCCAAAAGGTCGCGCTT
GATAAGCTGACCGCATCTTTGGGTCCAGATTACGTGAAATTCCTTGTATCGCAAGGCCCAGAGGTCCTTACTGCACGTTCTGAGGGCTTCTTGCAGTATG
AAGCGTCCCTTCTAGGACAGGTCCAAGACCAAATGGCGTCGGCTATGCCTACACCCTATGTGTCTGTTCCAGACGAAGATGCTAGGATTCGTCCACTGAG
AGTGGAAGTTAAAAAATACTCAGGAAAGAAGGGTGAAAACCTCATCCTCTGGATCCGTGAGATTGAGATGGCCATGAGATCAGGCCTGATCAAGCTTGAC
CATCAACAGGTCTCGCTGGCTATCTCAAAGCTCAATGGAAGAGCTAGAGAACGGGCCTTGACGTGTAGCACGTCGGTCGACTTAGCGTTTCCCACATGGG
AGTCGCTTAAGTCACAATTGATACAGGTGCTTTCACCACCTAACCAGGCTTACCGCGTGCGTTCACGCTTTTTATCAACCCGTCAGGGTAAGAATGAGTT
AACGGACTATGTCCAAGAGTTGAAACCTCTCATGGCTGCTATGCAGTCTGACCCTCTGCCTGAGGCAGTCCATGTGACTATATTCATGGAGGGTCTCCGT
ACTAGCATTGCCA