Description :
From Genome Similarity Track
Location :
Scaffold_240:33149- 34978
Transcript NameFunction/comments
Phymu_g7371dicarboxylate/amino acid:cation (Na or H ) symporter (DAACS) family protein
Phymu_g7372hypothetical protein PHYSODRAFT_558741

Sequence
1829 bases(100 bases per row)
ACACGAGCTCGAAGATGGCAATTGAGAGGATTGTGCACAGGATCAGCACGCCCACGTGTCTTGCTGCTTCACCGAGCATATCCTGCCCTGACAGAGAACC
AGCCACGAGCGACATCACGGCAATTGGACTCCAGTCTATGGCCTTGCTGAtgacgtggaagaagacctTGTTCATCTGCTTCAAAACGTCGAGAAGGGGA
CTGCTCTCACGAGAACTCGTTTTGACTGCCGCGGCTCCGAAGGCGATGGCGAACGTCGTCACACTCAGTATCAGACCTTgctcgaagctcaagaaaaTGT
TGGATGGCACGAGCTGGTTGAGGATGTCGGTGATTTGCTTGGACACTGTAGCGGCGGCACTCACTGTGCCATCCGTCAGAAGCACTCGTGTCGGGTCGTA
GAACTCGAAGCGCGTCGTGCCGTCCATTGAAGTCGCTGAGCAAGAGGCTTCGCCCGTGGAATTGTACGACAAAAAGCTGCCGTCCTCGCACATGACGTCA
AAAAATGCAGAGGATGTCTCGACAACTACGCCCTTGGTTTGTGGCACAAGACCGCGCAGTAACATGGAGATTACGAGCGACATTGCAGACCCTACAGAGG
ACAAGGCCGTGAATATCAGGGCTGTGCGAGTGCCGACGATTGATACTTTTCCGAGCAGTACGATATCGGCCACAGTCGTGGACAAACTCGTAAACACCAT
GGGGACCACGAAGCATTTGAGCACCTGCAAAAATATCTTCCCCGGCACATTCACGATGTTGCTGAAATCGTCCGATACATTCAGTTTGGACAGAACCATC
CCGAGCCCCAAGCCTGCCAACGCGCCTAGCATAATCTGCGTCGTGGGCTCCCGAAGCAAAGCGCATCTACGGTCGCGGTCCGGATAGACCACTTCAGGCT
GCGGGGGCGTTGTCTGGAAGGCGTACTGCTGCATCGggttgttgaagttgtagccCGGCTTGTAGTTGGAGTATCGAGACATGCCGGTACGCTCGAACAT
GCCAGTGATGGGGTTGTAAAcctcttcgccttcgctctcAGTGGGCGAGATCGGATCTACGTAGCCGGAAGCCACATGATTCCCACTCTCTACGTCGTAC
AGGACAACACGAGGTCGACTGGCCATGGTAAGGTAGTaacttccagcagtggtggcagcagcggaaAGAGAATAATAAAACGAGAAGCTTTTGGCTATTT
TCTTCGTAGCTGGCACCATCCCATTGctaaagttgaagttgtgtTATGTGCGTCACACCATTTTGATGGTCATCAGATACACATAAATGCGCGGAATCAG
ATACTAATACTGTCAATAAGGATAGTTAACTGTAAACAGTATTTTAGTACTTTGGTACTGTATAATATAATTCACTCTGTTTAAACTAAAATCTCTGTAT
AACGATAAAAGAACTGTGTGTCCGGCGGATGCACTCCCCACATTGCCACTTcagttcctcttcttcctcgtctccaCCATGTCAATCCACATGCGTTCGC
AGCTCTGTACGTATCCCGCAACTCACTCTCACTGCCGTATCCCTGTCTAATTGCATTGCACTACGCGCAGTTCTCATCCGCCCGCAGTCCATTAAGCTCG
CGGCGCGTGCCATGTcttcggccaagaagctgcagagccGCAGCCAGGCCCTGGCGCTGAGGTTACCAGCGCGTACTCTGCCCCGTACgccgcagctcgt
cgtggCAGGCGCTGTATTGAGCGCGTCAGTGTCGCTGTTGCTTAAGGAGTCGGCACTGTGCCAGGACGCGATGCTGCTCGCAGCTTCAGTGCGTTGGATC
TGATCTGAACGTCTGCGAGACGTTTGCCA