Description :
From Genome Similarity Track
Location :
Scaffold_42:33148- 45534
Transcript NameFunction/comments
Pytap_DAOMBR444maker-pag1_scaffold_42-snap-gene-0.46Dynein heavy chain

Sequence
12386 bases(100 bases per row)
GCTATGTGTCGAGCATACAGAGCATGGCACAGCCTCGGCGGATCCAATGGTCGGGGTCTTTGTCAGTTGGTACGTCGAGAGCGACCACAAAGTTTGTCGA
GTGACCAGTGGTGGACAGCGTGCCGGCACGGATCGAcgTCTTGTACAGTGGGCACTCGTACACGTCGTGTGGCTTGTACTCATCCCGCTTCATGGGCTTG
AGCCAGATCACAGGCATGCGATCGAAGAGCTCGCCTGGAATCGACTCGGCCATCATTCTCGCGTTGCGGTCGAATCGGGCACCTTCCATGAAGAGACCGT
AGATATAAACGCCATACGGTGGCGAGCTGTGATACGCTTCCTTGTCTTTGGACATAATCTCACACGATACACAGAGTGCATCAATAGCGATCTTCTTCTC
ACGAGAAAACGATTGCTTCACAGCCGTCATGAAACCTTGGGGAAAAAAGAAGCCACTTAGCCAGAAGGTTGtcGGCGGACCTTGTGTTAACCATTCTTGC
GTGAAATTGATACGAGCGAAGAAGTCCTCGATCCAAGACGCCAGAGGCTTGAGACATGGATATCCAGCATCTTCCCACTCTTTCGGTATTTGCTGAATCA
AAAaCCCGTTaTACATCTTCTCGAGTGGCCCTGACATGACAACGAGGCCCTTGATTGCACGCTTAAGCATTTCCAAGGTTGACTTCATCACCTTGATCAA
CGCATTGAAACGAATCATCTCTTGGGATAGAAACACACCCAGGGAATTGCGACTACCACCTGCAGCCTCCTTGAAAGTTGTAGGgTGGCCTTTGCTTTCC
ATAAACAaGTCTGGCATTCGCTCTTGGATAGCAATAACCATATCCATGACGACGGAGTCaTTGCTCTGAGCAGCAGATGACCCACCTGAGCCACCGTCAC
CACCTCCTCCTAGCATTCGCAGGATTGTCCCCAATAATTGGCTTGTCTCCTTCTGCTGAAAGGTGATGTCAGCGTTTGCATGTAGCCCGAAGATATCGGG
GGCGTCTACAGTTGGAAGATtcTtAACATAATCACGAACAGAGGTGAGGGAACCTTCAGGTGGGGCATAATAGAGCCCACTCGATGTGAAACGGTAGTTA
TCGTCCATCACTTCTCGGCAAAATAGCTTGCGCATAATGCTGGAGTTGGTCCGTTTGTCCCAACGGTCTGTGATCCGACCTCCGTACGAAATATCAGCCA
CCATGACGTTCAAAGTTACATAGGGAACAGTGTCTTGTTCTTCGAGGTATAACTTCACTTGTTGCATACCcGTCTTTAGATCACTGTTCATCCATTCATA
CGGAATATTCCACCCAACGGCTCCGAACTTTCGACGCTCCAAACACACCGCgTTGTAGAACGCTAAGGCAAAGCAAAGCTTCTTGAATTCTCTTCCTTTC
GTGCAGGCTTCATAATCGGCCTCTTTCATGTCCAGGAATGTGCGGCCAAGATTAGCCTTAATGCCCTTTGGTGGCTCATTTGTGATTTTGATACCGTTTT
GAAGAATTGGAACAGGAAATTTAGGGCTAGGCATACTTGTGAGCCACAAACGGAACTCTGGGTGGATGTcGgCTTCACCAGATGAGGTGCCTTCGAGAAT
TTGTTCAAGCCGTCCCAGCCATGacACTGCCAAGTGACAGTTTTGGAGGCACACCCAGTCTCCTGTTTCTCTCGCCTGCTTCATTAGAGCTTCCGCGATT
GGCCCTTGACCTTGTCCAAGTGAAATGATTTTCAGCCCTGATCCTTCcTTACCcTCCTGCTTTGCCAGCTCCAAAAGGTAGTCATTGATGTCTGCACCGG
GAGAGAGAACAAAGATCAGTGGCGTCTCCGGCTTTGAGTCTCGGTAACAACCCTGAAGATCAAAAGGTGGCGATTCTGTAAAAAACTTGCTCAATTCTCG
ACCAACAAACTCACGTGTGCCGAACACGAGCATCTCTTCACGGAAGACTCGAAGAACGAGAAGCTTCTGGAAATTTGTAAGGTTTTTCTCCCAGGGGTGA
GGAAGTGGCTCAGTGTGAGGCAAGTCAGATAGAACCATTGCACGTTTCCACTCGTCACTATGAGATATAACTGATTGAGCTAGGTCATCAAAGGCTGGAG
AGATCTCTTTCATCCCAAGCAATATTTTCCAAACACGCTCAGATATCCAAGATGGCTTCACACGATTTGATGCAACCGCGGCAGAGACTGCAGCATTCTG
CGCGGCAACACTTCTCTTATCACCcACCAAGTAGAAATTCCATTCACTAGTCGAAATGGctCCTTTCTGAAGGAGAATATTCGCAGCGATCATGAAAGCA
TAGATAATCTTGTCCTTCTCAAATAGACCTCTGCACACGTTAACGAACATTGAGCGCGTGATATCCTGCATCAGAATTtCtAATCGTTCTTCTAACACAT
CGGACTTTTGAGAATTCTCAAGCCGCATAACGAACAGCTTCTGGTAGAACTGCAATGAGTATTGATACATAGGGTCAACAagAGCCAATGCAGCAATCAC
AAAGTAAATAaTCGACCcGCGAATCGCGACGCAgcGGTAACCTTCTCGTGTCTgaTCtATTTCTGTTGACGTTGTCTCTGCCTCTGCCATCCGAGTCTTA
ATGgCCGACGAGGTGACTTTACTGTGCGCCAAAGTATCAATAAGTTCTTCGTCATCCAGGATGTTACCTTGAGAATTTTCCAACATATaCAAAATCTTGT
CTTCAATCTCTTTGAGTTGCTTCTTATCAGATGCGATGTTGATCGTCAGCTCGTTCTTCTTCTGTTCAAGATCTGGGCGCTCACTGCGCACGACATCAAC
GAGCAACTGGTCTTCTAGACCTGTTAAGGTGACCGTGAAGTTAATCACAGTGACCTTGATACAGATTTCTGGCATGTAATGGGGGTTGGCAAGCTTtGTC
GTGATGTAGAAGCGGAAGTTTTCGCTGTAAGGGACATCACTATCACCGAGATGCAATAAGAGTTGCCCACCACGCTTGAAAACCTGCTTCAGCAGAACTG
GTTCGAGTGATGGATCCAACTCCTCTTCGACATTTTCAAGAAGAACCGGAGCACCGTAGCGGATCGCGTTTtCAAGTGTTCTCAGGAAATCcTTCTGAGT
gAGTTTTATGATCTGTAGaGAGTTGGCCTGCTTGTACATGTTCTTTATCCATTTATTTGCTTGTCCTTGTGGATCAATCATGAGCGGCCACCGCcGGCCc
ATTGTTGTgAaCAGTCCGTTTTCAATCGAAAAAGTATCTGCTGGTAGaCCCATAATGTTCCATTCACGTACAACAACAGGATCAGCCATGACTCTCTGAA
ATGAAAAGTGCCCGTCTACAGGCAAACCACTCTCCTTGCAAAATGTTACCCATTGCATTTGCAGCTCGTGGCGGAATTCTGCTGTGAATGGACCAAGATA
AGCGATACACCCGGCAGACAAGATCATGTCTCCAACAAGATTGATCATATCGATGGCCAAGTTTTCGGCGCATTCTTTCCATCTTCCTTGTTCTTCGCCT
AATGAATCGATGAGTCGCTCTGCACGAACAAGCTGAGCTTGTGTCTTTTgaGACTCCTTCTCTAGATCAACTTTTTTTtGTTGGGCTGCTTCGAGGGTGC
GTTTAAGATCAGCAACTTTTTGAAGGACTTCGTTTAACCCAGcTTGcTTAACGGCTAATTTCTGCTGCTCAACTTCCAGTCGATCTTCTGCAGCTTTAAG
AGCTTCTTTCTTTGGTGCGATGTTCTTAGCGACAGTATCATATGTATACATTGCgcGCGCCCACATGCATAGCGAGGTCGCGGCCGTtGAGATACTGCTT
AGTGTTTCAGGAGTAAaTtCCTCGTCAGCCATGAACTTCGCTAATTGTTTGATCGTTTTCGGTGGAATGTTATCCTTGTCGAAGTCTTTCAGTTTGTCTA
GGAATTTCATGTCATTTAGCAGTTTCTTAGCTTCGTTCCATtCTTGCTTGGCACCAAaCAAAAGACACACTGCATTCATTGTCACTCCGACAAGACGAGG
CGGgTtGGTGAAtGTTTTCAACACTGTGATGTCAtCCTTTTtcAACATAcTGAGTGCCTTGATAGCTGCATAATATGCCGGCATTGCctCATCCAGATCC
TTTTGACAATCGTCTTTAATagTCTTTACCTCGGCGGCAATTTTGTTTGCTTCTTCAACATCTGCCTGAATTAGTTGTTGCTGCTTATCAGCCTCTTCTT
GGTCTTtCGCTACCCGAGTTAGCAGGACGGCCGTGTCTTCTTGTGCTTTAACAAGCACAGGCTGTAATTCAGTGAGTGATTGCTTCAGGTTGCCAACAAT
CTCTTCAGTTTCGAAGAGTTTTTtCAATCCACCACGGTAGCGAGCCTCTTTGGCACGGACGACATGCCGTTGATTCCGAAGCATATCCACATAcaGCTTG
ATGAGCTCCAAGTAGCTCGTTGGTGTAGTGTAGTTGCGGCGCTTGAGCTGATTGTAGAATCTGGCTGTCGCGTCTTCCACGCTTCGGTGAATGGTCACCG
CCATGTTGCACAACGTCTCCACATtATTCTCGATTCCCAATTCTTCTGCaCTGGTAGCAAAGAACCTTTTCGCAACTGAGTGTAACGCGTCCTCTGGCCA
CGCATTGAACCAATCGATAGTACAGCAGTTCACCAACGACGGAAACATACGACAACGGTTTCTGAAGCCAGCGCCAATAGGTGAGAATGCCAGCACTATA
TGGAGATTCTCTCTCACGAGGGTGATGTAATGTTGCAGAATATCCTCACGGGTGACTTTACCAAGCTGTTGGgCAATGGGTCTTACCATTCCGACGATCT
TCTCTAGTTCATCGTTTGCATAGAGATTTGGTACATCACCTGTGTTCAGGACGTTGTTGATGTCTTCAaGAAAAGATtCTTGGACGATTTGAGCGTCGGA
GAAAAGAAAAACTACCGGTTTGTTCTCTGCGCCGGCtGTCATTAGGATCTTCTTGAGATCTTCGTGGAACTCGTTGGCACCATATCCGCGTGTAATCTCG
ATAGTGAACGTTTTATAATCTGCCATGAACGCTGCGAGGCGTGTGAGACTTTGGCGACCAGAACCGCCAACTCCAACAAGAAGAGCATTtCCTCGTGGCT
GTCTCAAGACACGACAGATACGTGAGATGTGGTGCATGGCGTCGTGGAAGAaCACGAGATGCATTTGGCTCGGAAATGTGATATTGTACTCCTCAAGATA
CTCAACGAGCAATCCGTTCAGCTTTGTgaGATCCTCAACAtgCCGATAGGACTTGTTTTCCCGAGTGAGATAATCACCATATAGCAGATTCTCGAACTTA
TCTGgAGACCAGGACACTTtGCAGTGCTCGAGTAAGAGATCTGAGCATGCTTTATTAAACCAAGCGCGGTCTTGGGCATCAATCAGTCGATCTCGAAAAA
CCCGTGCTTCTTCATGCAGCCATAGTTTGAGTAAGCTCTCTTCACTgACAACATTTTCTTTCTGAACCATTAGAACACCCTGGAATACTTTGGAGAGATC
ACGAAGGTTGAATGTATAGTGTGACTTTGATGGGGTCGGCAGCATATCAACTTCAACACGCTGGTACAATTGAACAGAGGCGTTCACGATTGGACCGGCC
ATTTGCACCATCATGGGTAGTTCATGACCGAGGAAGCCGGCAAGAATTGACGTGAAAATGCGTTTCATCACATCTGGAGACAAGTTAGGAATCCACACCA
TGTGAAAATGACGAAGTAGTCGCGgTGTGACTTCGCTCCTACCACCACCAGGTGGAGCGCAGGCAGCAGCGAACAAAACATCTTTGATaCTCTTGAAGAA
CATCTTCGACGTATCGTAACAACCTCCTTGATCAATAATTTGGCGAAGAAGTTCATTTGGTGGCTGGGCACCGTACACTTCTAGCGCTGGCATATTCAAA
TCGTCTACAAAGAAGAGCATCCTCTTTCCTGCCGGAGGACCAAGCAAATTCTTGCGCTTCTTCTCCAGCTTGATGTCAAACTGCTCACCAAGGTTTTTTG
GTTTGGTTTGAGCAGAGTACCCCATCGTAGCACTGATGCAGCTATCGGTTTTAGCCATCTCGTCGAGGAATGATTGAATAATCACTGATTTACCAACGCC
AGTCTCACCACTGTAAAGAACGTGGTGATCATTCAGCATTAGCTTCTCAAGTAAATaCCGGAAACGGGTCGTGTCTTGAGTCGGCACGACCATACTGAAG
TAAGACgCGCCAGGTTGAAAGTGAAATTTGGGGGTCTTTTCTACCCATGaCACCCAACGACCAGTCGTCTCGTCAATGAGGACGTCGTACACGTTCTCGA
CCATTGCTGATCCGCCACCGTTGTTGCCATCACCATCGATCAAGGATCTAAACTGTGACATACAGAAATCATTGAATCGCGGTCTAGAGTAGTCATCAAT
GTTTGCCCcGAcAGACCATGTCACAGCAAagaCGAAGTACATTCTCAGAAGTGCTGCAAGATCTGTTACATTACTCCCAGcTTGAGCGGCACCCATGGAT
AGGCATGACGCCAATAAGTTGAGACAGCTCTGCATCAAATTGGCGTTGTTACTTGGGATTTTCTCTTTGCAGTGgTCGCGAAcAAACTGGATTGCTTGCG
GCACGTGGGACTCAATCAGCTGCAAGAGCATGCTACAAAGCTCGTTGGATGATAAAATcTtCTCCAGAGTTGTCACTTTCCAAGTTCTTGCCAGTGAGCA
GATGCCGATATGCACTTGTtCCATGTACACCATACCACACCGACTTACGGTGGCAGGAGATGCAACCCGTAAATCCTGAACTTCGAACATCATATGTAGC
GTGTGTGGAAGTTTGATTCGTTCGCTGTTCGAGAGACATAACGTCTTGTTATCATCTAGCACAGTGTTCATATTCTCAATCCACACGGCATCAACtGGCC
CATCAAATATCACCCAGTTGCGGTTGTCGTTTTCAGCTGCTTCCGTGACACACTGCCGGACAAGCTTGGgAACCAGCCCATCAGTCCACTCATTTGTCAG
TAGGTTGAACTCACCATACAGCTGACCGGCAGAAATTGACTTTGGATTCAGTATCAACCGGTGAACTTCTTTGTAGAACCCGTCCCGgTCGACCACACCG
TCCTCGTTAAGCTGGGTGAGCGCTCGCGCAAGTACATACCCGTTCGTCGTTTTCCCACTCCCGGCTTCGCCCACCAGCATCATACCGTGACGCACGAGCT
GCGTTTCGTGTACTTGAATCGCCTTCGTGATGAACGAAGGAACTGgCTGTAggtttAAGATCTCTAGTTGGTTCTCAATCGCTTTCTGAAGCAGACCATA
ATCCACAAAGGGTACGACCACACCAGGAAATAAATCCGCAATGATTCCTCGGAAGAGGGGCAGGTCTTGTTCCAGAAATTTCGGAACGTTaCTATCTCGC
ATCGCTCGAATCAATAGCAAaTCTTCGATCATCTCGGGTTCTTTCCGTTTCAGTTGACCTGCAGCAACGAGAACCGATTTCACTGCGCGCATACCGAAGT
CGTAGTGATCCTGTTTGGAAAGTTGTTCGCTAGAGAGGGAATATAGTTGAGTCATTTTGTGCGACAATGGCAATGCATTCGCGAAACCTTCAGAAAAGAG
CACAATTTCAGCAATCAATCGATAATCGGGGACCATCATAGCCACCGGTCGAAACAATGCTTTCAGATTGTCTGGCAGTTCGGTTCGACCAGCGTAACCA
GGATTCATTGTAATGAACACGCCGAAACCTGTATTTAGACgAATCATCTTACCCTCAAATTCAAATTGATCCACATCAGCAATGATTGCCTGCTGGATGC
ACAACACCTGTTGCGCGATCACGGACAAGACTTCGATATCAATACGaTTAAACTCATCAAAACATGCCCACGCTCCAGCTTGTGCAAGACCAGAGAAGAA
GCGACCCATAATCTTGTAGTCCAACCcGTCCGAGCAGTTGAAGACAACACACTGAACAGCAAGAGCTTTCGCAaGATCTTtCGTGGTCTCGGTTTtCCCc
GTTCCAGCAGGGCCAgCGGGGGCTCCACCTAAGCGAAGATGCAATGCACCCGTCAGAGTCATATAACAAATGTCGGTGAGTGGTGTAATAACCAGACGAG
GGGAGTTTCCTAGGTACTCGTAGCCATAGATAAATCTGGTGTTTGTCTGACGAGCGACAAAATTCTTCACATCATCTTCCCAGTAGTACCGCAGTTGACG
AGTCCACTCGAAATCACTGAGAGATGACACCTTCGATTCGTCCAGAGAGCGAACTACATCGCGAGCATGAACGTCGATTGTGATTAGTGCTCCCATTAGG
ATTCGCTGCAGTTTACTtAACGGGCCGCGTACAAGTTGAACCATTCCGTCGATCTGCCGTAGACTGAACTGCAGAAAACCATGAATTGCGCGAGGATCGT
TACCGTTTTCAACTTCCATGATTGCCTGAGTGACATTCCTTGTCCAGAAGACTTGATCGACAAGTATGATGACCTGAGCCGAGTATGAGAACAGCCACTC
CTTCCGGTCGATCGCATCCTCGACTGGATAGTTTGTCAATGCCTTGACTCCGTCCTCATATAGCGATGATCGCATCCCCTTTTCTACCTCAACTAGCCAA
CTTTCgaCCGGTCCTTGGGCTGTGACGAGAGATGGGAAAACCACGATCTCACCCTCACCACTGACCATGGCGTTGATTAagAAAGGTGTTGTTTtCCCAG
AATTACCCGTTGGCAGGCCTGATCCCTCCTCAAATCGGATACTCTTCATAGCGTCAAAGCATTTACCAAGGTGAGGCTGTACAGCTCGAGGGTCACGAGT
CTGGGACAAGATTTCCAGAAGTTCGTCGTTCGATAAGAAGTAAAAACGCGGGAACGCCATCCGCTTGGTTTCGAGGTAGTCTTCTAGCGACTTCTGAATC
TCTTCGAGGATCTTGTTGGACATTTTGAACTGGTCGAGAATATCTGTCCCACTTTCGACTGACCTGATCACGCTCaGgTCAATGCTGGTGCGTAACATTG
TGTTCTTCCAGTTCTTATCAACCAAAGCAAACTTCTGTGCCTCGACAGGAAGTTGTTTCTGAATATCTTCAGCACAAAAAATAGTCTCCAAGTACATCCA
GCTCCGTTGACATTGAATCCATTCATCAAGCGTCTCAGACAATGTAGACAACTTCTTATTCCACCGATCAACTTCGTCTTTCACACCGAGAATGTAACGC
GATCCCATCATCGTCTGCAAAgTGACTTGGTTATCTTCGAGTAATGTAAGAATTTCTTCAAGACTGCCCAAGATGAACACGTCCTTTTGATCACGATGGT
TCAAgCATATAAATTGCATTTGATCCCAACCTTGTTTGATCTTCATCAGTGACGCTTCGATTTGTGCTTCACCAGATGCAGTTGATGACACCTCACCGAT
CAGATCCTTCATCTCAAGTGCCTCATACGTGATGAGATTTTCAAGTGTGAATgTGATACCAGGATACCATGGCTGTCGCAACGCCTTGAATATCTTCTCC
CAGTGACGATCTTTCATGGCTGGATTTCCCATTTCAAGAATGGTAGGGATCTTTAGCTTGAAGTCTGCAGTACGATcTTTGAAAATGGCTGTAACATCAT
TACTGAGCTTCTTATGCATTGCATACGCATCCTTGAATGCGACGGCGACATCTTTTGCCAAGTCCTCCGCATTGACTTCGACGAACGGGTTAGTCATGGC
ATTGtGGAACGTCGTGTTCCAGCGTTCAACTGACAACCACAATGACTCGACCGTTCcAAAaTAaTCCTGCGTGGCTTGTAGGTTCAGGTATTTGAAGGGG
GTCAAGTTGAACAAGACTTGATACTCGGTATATTGCTTTGAAAGCTCGTCAAGCTGTGTGAGGCGCTGCTTAACGGTGTCAAaCTCTGCTTTGACGTGAG
TTGGGTCCTCAAACTGGTCTGGGTCGATGAAAATACCTGTCTGGAGCTGACTATTTAACTGGAGGACTTGTTCGTCAAGTCGCTGGATGTTCGCGTCTAA
CTGCTGTGTCATCTCGCCTAGGCGACTTTGAATAAATCCATCGACAGCGTCTGTTTCTTCTCGATAACTTTCTTGAACACTGCGAAGATCATCAAGTTGA
ACCATGTCTTCAGAGGATATCCGCACAGCGTAATTACTTAGCAAACGATAGAGTTCGTCGACGACGTTGGTGTTCTTAATTAACGCTTTCTGCTTCGACT
TGAGTGCTTGGACTCGTTCCACATGTCCAGCGAATTCCTTCAAATGCTGCGGTCGCTGCAGAAGCGCTTGGATGCGTTGTTTGTACTCAATGAGCTGGTT
CTTACACTTTGCTCGTGCAAGATCTTTGACCAAGCCTTTCATCGCATCCAATTTGGCTGTCGTCATTGGGATCAATGTCTGCTTTAGTTTtCGACTTTCC
ACGTGTAGAATCCCGAtcGTTTGGCCAGCACGCATTTTCTCAAGCTCTTTCTCCCACGTACTCATCTGTAGCATGTCGGCCTTTAGGGTAGTAACAGTGT
GTGATCGTTGCGAGTACTCTTCGAAGTCCCACACCTTATCGTACTCGTAAATAGGACGAACATTGTCAAAaTTTTtCACATACTCTGCGGCATCGGCGTA
GTCGCTGATGATCTTTGCAACCAACTCCTTCCGGATTTGCTGGAAGTCCACACTACTACTTATAGTCGTACCAACATGTGGCGCATCGACCACAACATTA
GCAACGTACGGAGCAAACGGCCGTAAATATAGCACACGAGATACCGAGTTCACTGTCCCGACGATGTCATCTGTCATGGAGATGACAATATGCTGTATCT
GTTCGCATGTGGGAGTGAAAaCAGTCGTACTCTCCTCTCCgAAATTGATTGTTGACTCGAATAACCCTGTCTTGCGTGGCACTTTGTTCAATtCAAGCAA
AAAATCACGGCAGCTTTGCACTGCGAGAATCACTAGGCTCTCTACAGCTATGTAGTCGACTAGTCGAATAAGATCAGTGATCATTGCTGCTTCTTCTGCT
GCTCGTTTGAaCAACTTCTTCCGTTGCTGCTGCTCTGATTTTACGGCGACAATCGACTTCGTCTTCTCTTGACTGCCCCCACCGCCTCCTGAATACGGGG
TATCAGACAAAAAaTCATCCTGAGGATCGGGGACTTTCGTCAGATtCTTGACATCAAGGCATACTTtCTGGATTAGAGCCTGgAGCTTCTCGATGCACAA
CTCGAACTGTTTGGACCcTTCAGCACGCTTACTTGCTTGGTACTCAaCAAATGCATTACTTTCATATGTTTTCTGTGCCcGTAGATCAAGCAAAaCAACG
CTTTGGACCTCTTGACTCATAACCTTCTTGACTTGTAGTAGTGGCTGACAAAATGTTtCCTTTGCAAGATAGAGCTTGTTCTTCAACTTCTTTCGCTGGC
GACAGTAGAGTTTATAACGCACGTTTGCACACCACAATGAAAACGACTTGTGAATGAGATAATGCTTGAaAAAGCGGAGTGATGTCAGGACATTGAACAT
CGTAGACTGACGCATCCATTCTGCCAACGCAATGAACTCGGAAGGGCTTCCTGGGCTCATTCTAACCAATCCACTCGCCGACATCGTAAAGTGCTCTCCG
TCAATATCGTCTGGATCGACAACCATAAGGTCATATGGTCGAAATGCAACGCCGGTCTCTGCTCGATTTAAGTGGACAAATTTAATTTCACTGTCCGAGC
CATTCctAGCAAAAAaTGCAATTGCATCTTCTCCagATTTCAaGAATGtCGCGGCATTTGCAGCAGCGGCATCACTAGCAGGATCGGGGGgAATAaTGCG
AGCGACCCCTGTTTCTGGATCAATATGTTCGACAAACGTTGTTGGCTCTCCTTTCACATCGGTTCGTGAAGGCGATCTCAATAAATTTGAGTCTTCGTCT
TCATCTCGGTCACGGAATGAATTATCTTGTTGCGCCAGAGTATCACGCaGAAACTTCCGAGGTGATGGCTCGCGCTTCGGTCTTGGAGCTCCGGTTGCAT
CTGAGGTGAAGTGATGCCCTTGCGCATCTCGAGTCCCTAGTGCTTGTGTAAATTTTCCACTCGATGAcGTTGTTGCAGCAGCAGatAGTGAACCAGGCGC
TGGTGATCCTCCAGGTTGCTTCATATGAGGACTTCTACCACGAGCACGCACATGTAGCTTCTCAGGGCTATGAAGtGTTCCGGGAAATACAGGCACCTTC
TTGGGTGACGTGTATTCACCAGCATTTGTGAATGTGAACTTGTGGGGAGCTTGGGGAGATTGCGCTGGTGCCAGTCCATTCGCAGGTGATGAGACTGCAG
CCAGTGGTCGATTCGACGGCAGCGTTGAACCGAACCCGGTCCCACCATCAAATTCGAAGTTGGgATCAATGCTCAGCTCGTACATC