Description :
From Genome Similarity Track
Location :
Scaffold_104:33147- 34171
Transcript NameFunction/comments
Phypa_INRA-310PPTG_19146hypothetical protein

Sequence
1024 bases(100 bases per row)
TTGGACAGTTTCTTGACTCGCTCCTGTAGTTCCTGCTCTCGCTGTTGCTCCACCTCCAGCACACTACCGAGCTCGACGTCTGCGAGCTTCTTGCCTAGAC
CCAGAGCCCATGTACCGTCGTAGGGCACGGCGCTGCCACCGCCAGGGAAGCGTGCGAACTCCCGGGCCTGGACGTCGCCCCACATGATGTGCTTTTTGGC
ACCAAGGGAAGCCGAGCGGTTCTTACGTTGCTGTAGTGGAGCATTCGTAGAGGGCACATGCATGCTGTTACTACGTGCTTTGCGCTTCTTCTTGTGCTTT
TTGCTCTTCTTTTGGGGCTTGGGGGCTGCTGCTGCGGCCTCGGCAGGGATCTCCACGATCTGCACGGGCTCCGTGACGAGGCGTACGCTCTTCGGCGGTG
ACGCGGCCACGGTCGCAGCAGCAGCGTTAGGTATACCAACGCAGTGTATACTATTGGAGTGTATATGTGTCGTCTCGGTAGGTTGCGCGGAAGACTGTAG
ACACGTGGGGCGGTGGCTTGGCCAGCTCTTGCGCTGGCAGGCGCGGTCGCAGAAGTAGACGCTACGGCAGCCACCGCAGCGGTTCTTGGCGTTGGCTTTG
CCACAAGACAGGCAGATCTTGTCGAGGGTCGTGGAAGTGGTCATGGCGGTGCTGAGGTGTTGGTGCAGGTTAGAGATCCCTTTAGCGCGTGTGTTGTCTA
GGTCAGATTGGGAAGTGACGCAATATAATGCTCTACCCGCCGCTTTATCAGTGACCCAAATAGAGGGCTGTGTTAAAGTTGCACGACTGTTTGTGTTGAA
CACGCCCATGCTTTGCCCAGCTGCGCTCGACTTGGCGCTGAATGCATGGTGATTTAGGAACGCTATTAGCGGCGCCAACGTGTCGCTACGATGTTTCCAC
AGCGTGGATGCCTCAGGAAATGTGCATGCCCTGCATTGTCAGCGAGAGCTACGCTTGCGAGAGCTATGCGTTAAGACTGGTGGCGGGTGTGTACATGTTC
TGTAGCCACGTTCAATTCGACAGT