Description :
From Genome Similarity Track
Location :
Scaffold_10:33144- 34925
Transcript NameFunction/comments
Physo_307197Hypothetical protein

Sequence
1781 bases(100 bases per row)
GATGGCGAAATGACCGTCCAGTGAAGCGTTTCCAGCTCGATCCCTCCCGCTAGAAAAAGCCAAACTGTTTCCCCACGAGAACGACTCTGTTCTCCTCGTC
GTACTTGCGGTAGGCACTCACAGCGTCAACAAACCGCAAGTTGCAGTTGTCGTCGCGTAGTGGCAGAGTGAAACTCATTTTGAGAGAAGCGCTGCTGCTC
GCTCGCACCTGCACACAATCACAGCGTAGTGAGAACACGCTATACTTGCGAAAGAACTCGTTCAACCGGGACTTACGAATCGATACAGCTTTTCTGGCTC
CGTGTCCTTCCTGCGTACGAGGTGCTCCCACAGACTATTTCAAGCTTCCGCAATCGTTCTTCGCATAGGTGTGACGGAGATCACTTCGATGTAGTTGTAA
TCCTTGCACGCAAATGGCCCGTGACGTTTCTTGCGAGATTGCAACGTAACTGAGAGATTCTCAACGTGGGCCGGAAAGACAGACCCCGCTTGAAGATACA
GCTCGTGCATTGACTTTGCCATCCTTGTAATGATCTGCACGTGCAAGAGCAGAACACAACCACATCATCAGTTGAGTCCGCACGCAGAGAGCCCAAGTCG
TCGTCTGCATATTCACCGGTTGCGCAAGCTCCTGCTCCGGCACGCCTCAGCCAACCACTTCATGTTTAGGACCGAGCGCCATGAGGGCGCCCTCGGGTAG
ATGGATAGCAGCAAACAGACAAAGACATCAATTCAGTTTCCATTTTACTCGCAACACAACAAGCACAACCAGAACCTTACAATCCTCCCCAGTATGATGT
TGGCCGTGAAAGTCGTATCCAAGACTTGATTCGATTGAGCTTGATCCTGGAATACAAAGTCCTTTACCTGAGAGTGCATCCGTATTCATAAGTACCAGAG
AAACAACAACAAAAAATACTAGCAGAACCTCTTCCGTACCTCACATTTTGTCAGCAGTTCTCGAATGTTTGAACAGGTACCAAACAGGCTTGACAAACTT
TCCTTCAGCTCGCGGTTTGTGTGTTCGGAGTATTGTAGTTTCTTGGTCGCAAGTTCTGCAACTTGACGCCACGGTTCGCACTTGTTCTTGGTAAAAGCTG
TTGCTCCACCAACATGCTGTAGGTGCAGTTGAGCCAGCTTGTCTTCAAGTTCCCGAACTTCCAACCGCAATGACTCGACCTCCGCTTTCCTTCGCCGCTG
CAGATCAGTTGAGTATGGCACAGAACCAACCTTACAGATGCGCTTCCTACGTCGCCTCCCCATAGGAACTTTGTGTCGAACCGATAAGGTCGTGGCGGAT
CCTCCAACTTCAGCATCATTTCTAATTCCATCCGCAGAAACACTGTTGATCTCGGATCCCGGTTCCGTGTCAGTACCGCTGTGAAGATGACTGCTGCCCA
AAGCGTCCAGGATTTCCATCAGCTCCGATGGTGTCGACGAGACGTCATAGTCCATGATCCGGCCACCTCGGACAATAGTGCTATGCGATTCAATTGAAGA
ATGAGAGCCTACGGCGCACAGGCCTCCATTCCTGGACGTTTACGCTGAAGCCTTGGTCGCGAACAAAGGATTGGCTATCCGGTATCACTGTACGAAGCAA
ATCATCGCCTGAACGTGTCTGACGAACGATACCTGCCTCTTTAGGTGAGCCCACGCCAACTGGGTTTTATTTCTTGTTCTTCACGAACGAAATGATACAG
TCGTCCGCTTCAGTCGCACAATCTTCTCAGCCGCATAATCAGTCAAAAGTCACCATGAAACAGCAGATGAGTGTACACCGC