Description :
From Genome Similarity Track
Location :
Scaffold_57:331424- 333784
Sequence
2360 bases(100 bases per row)
TCTCCAACACCTCCACCGAGAATTCTACTCCTCTCCTTGTCATTTTCCGTCGCGTTCACACTTGTTATATAGTCATCAGGCCATTTACTCTGCCCCATGA
AAGAGAAGATACATTCTGCTTCCAATGAAGGCTCGGCTAAGTGTGGCAGCCCGATAGGGACCAATCCAGCTGTAGTTGGCGGGCTGCCTAGTCTAAATGG
CGTTCCTGAACGACAGCCTTGAGCTCTGGTGGGAGCTCCCCTTCGTGCCTTTAGTACGCACGAATTTGGCAAGGTCTTGGAAGCTGCGGAAAAGTTCGCA
CTGTCCAGCATCGTGGGGTTGTTTGCCGAACGTACATCGCTTGTTACAGTAGTGGGCGGAGTGACTCATGCCACCGAACACCGCCCATGATCCGTAGTGT
GGGCGTCTGTTGTCGCCGTAGGTCCTGATTGAACCCACGGTCACCACCTCGGCGATCGTGATTGAAGCCATTCTCGCGACCAGGCGTGTTTCCACGCGTC
TGACGGTTGTCCGAACGTACGTAGGTGCCTTCAGCAGCTGCACGGCGCTCGTTTTCGTTAGCAGCGGCGAGGTATCGGTCGTTTTCATCCAATGAGAAAT
CACCATCCGTATTATCGGGCTGAAAGTCGTTGTACTCATCTTGGACATTGTCGTAAGCGTTCGGATCTTCGTTTGAATACTCGTTGCCTCCTTGAGCAGC
TTCACGACCTTCTAATTCAGCTAGTAGGTCGTCCACCGTAGCTTCAATGAGTGTCACTCTTGGTTTGTTGGGGTTGTCATCGCGGCGACGGTCATCACGC
CAGTTGTTGCGGGCGTACGCATCGTCGCGCATCACGATTGTTGGAGTATCGATACTCACTGTCGCGCTTGGCCATTCTCTCCTTGCCCTTGAGAACGTCT
TCAATGATCTCTTCGAGCTCGTGAATGTCGGCGACTCGAGCGTGGTATAGACTCTCCACCAGCTTGTCATCATCGCATGTTGCCAGGAACTGCTGTACGT
GTTCTTTCTCGTCGCGACCACTCTTCTCAAAGTGTAGACAGGCGGTCCGAGCGTAGCCATTCAGCCTGTTTATGTAGTCGCACAGATGTTCGTTACGTTA
CCGCTTTTCGGAGTAGTAACGGGACAGTGCCGTCTGCGTGAAGTGCGAACAGTAATAGCTGATGAACGCATTGCTCAACAGCTTCCACTTGCGCTTCGTC
TTCTTCGGAAGTTGACGGAACCAATGAACGGCTCCGTCCCGGAGACTTAGCTCAAATGGAATGCACCATTTGTCGGCATCTGTGTGGGTTCCAGTCATTT
CATAGACGAACCCACGAAGCCACTGCATACAGTTCTCGCTCTTGTTGCAAGAGCCTGAGAACGGCGTGATGCGATCCAATGGTCGGTGCGATGCCATTTT
AATCCTCAGTGTCGGGTCTACGTCGTTCAGCGTCGCAAGCTCATTCATCTGACGCATCAACTCGACATGAGGATCATGCTCGTCGAATGTACGCACCAAA
ATGCCATCGTCACTGGACGAACCATCGCTGTAGACTTGACGACGTCCGCCACCACCTTTGGGAGCTCGCGGACCGCCTCGGCGACCGAACGAACCCTCGT
TGCCAGCGTAAAAACACGCTGCATACGGCTCTCCGAACGTGGCGTAACCATGTGCAAGTCTTGAAAATACGGTGAAGCTTCGGTAGTGCCAAAGGCACTA
CGCTTAACTCCACGCTTGGTCGGAGGAGTACAAACGAGTCGACGGGGTGTCGGCGGCAGTGGAATCGTGGACGGATCTTCATCGTGAACGATCGTTCGAC
TCACAGGCTGCTTTCCAGCGTTGATCTGGACAGCGCCAAATGCCTTCCGAAGCTTCTTCTTCCATTTCTGGAGAGCAGCTCCGGCTTCATGAGGTCGCCA
ATCTTGGAGCGACATCGCCGATGTGTTCGTCTAATTCTCAAACCCATGGACAACAGTAGAGAGACTGAATCCTCGGCAACTTGGCTAGTCGAAACCGAGT
TGACTGGGTCTTCAAGTTCCTGCGTAAGCGCAGGCCAGTCGGCCTTTATCTTGGGGTTGGACTTGAACAGCTGCATTCACGCATCATTCTGCATCAGCGC
TTGTACGCGGTCGAAAACGCGCTTGGCGGCTGGTGTATCACCGTTGATAGGTGGGCGAGGTGCTTTCAGCGATGCTGAATGCTTTGCACTCGCCACCGTA
GGCTTAGAACCCTCGGTCCCATCGTCATGGTCTTCATAGACCGGTTCTGGTCCCGCAACGTCATCGAGCTAGTCGGCGAGGTTCCTCGAAAGGGACCTGA
TCTCCCCGCTCAGCCCCGATGATAGCGTGGCCGTCTCCGGTGTCATTGCACCTGGCTCTG