Description :
From Genome Similarity Track
Location :
Scaffold_8:33141- 34801
Transcript NameFunction/comments
Physo_129495putative polyprotein

Sequence
1660 bases(100 bases per row)
TAGGAATATCGGCAGGAAGATATCGCTTGAGGCGCCCAACGTAGAAAGTCGGGTGAAGACGTAGCGACGACGGGATGTCCAGTGTGTACGCGTCGCCGAG
GACCTTGATCACCTTGAACGGGCCGATGAAGCGCGGCGCGAGCTTGTTGGCACCGAGGTTGGTCACGGCGGAGGAGCGGATGCCTTCGGTAGACAGTAAC
CCACGGTCACCCGCGCGAAATGAAGTCATGTTCTTGCGTCCACGCTCGTCTGCATTTTCCTTCTGCCGGTCCACTGCGGCTTGTAGTGCGTCTCGCACGA
AACGTGTGATTGCTTGACGCTGCACAAACTCGGAAACCGCCAAGTGATCCGTGGGACTCGCCGAGGACTTCGGTGCATAGTTGACGGTAGTAGCTGGTTG
CTGCATCGTCGCTGGAGCGCCAGCGGGGTCGATCAGAGTTCGCTCTGTCCAGTCTGCGAGCGGCGTCACCGCTCGATGCGGTGCGGCAAGGGCCTTCTTC
ACTTGGGATCGTGTCACTGCATTTGCGCTTGATTCGGTCACTGGGAAGCGTGGCGACGCCTGTGAATTGACCGGCGACGGCTCCGCCGGCATCTCGGTCG
GCGGAAAGTCTTCAGCGGTAGCTCCTCCCCCGCCAAGCATAGAGACACGAGCCTCCGTGGGTTGGCCTACGGCAAGCATGGCGGGTACGCGCGGGTGGCG
GGCGGAGTTCACGAAGAACGGAGTCATGCCCGTCGACGAGTGCTCGGCGTTGTTCAGAGCGAACTCGGTCAGGGGTAGGAAAGCGCTCCAGCTCGTGAAC
GACATAGCGTAGCTGCGGAGCACGTCTTCGACGACGCGGTTGACGCGTTCGGTTTGTCCATCCGTCTCCGGGTGAGCCGCGGTGGACATCGGCAGCTTCG
TTCCAAGCAACTTGAACAGCTCCGTCCAAAACGCGGACGTGAACCTCGGATCCCGATCCGAGACGATGGAATCGGGCAGACCATGAAGACGGAAGACGGC
GTCGACGAAGTGGGCTGCGGACTCTTCCCCAGTAACCGTGGCAGCCACGGGAACGAGATTCACCATCTTGCTGAACCTGTCGACGAAAACGAGGACTCCA
GTGCGCCCGTTCGAGTCGGGTGGAAGACCGAAGACGAAGTCCATCGAGACGAAGCGCCAGGCCTACGTGGGGACCGGAAGGGGACGCAGCGGAGCCTGTG
ACGACGGCGAGGGCTTTACTCGCTGGTAGATCTCGCAAGTGCACACCCACTTGCGCACCCACTTGTACAAGTGGGGCCAGAAGAAGTCTCGCGCCACCGC
CGCGAAGGTCTTTTCGCGTCCCAAGTGACCCCCGATCGGAGCATCGTGGTACTCATGGATGATCCGGGCGCGAAGGTGTTCGTCATTCGGCACCACCACT
CTCGGGGCATCGAGCTGGTCGATGGTGTATGTCAGCAGGGAGCCATCAAGCCGATATCGCTCGACGTGGCTGCGGGTCGAGCGCGACAGAGCCTTCAATG
TCGCCTCGCTTGGAGAGCGGAGGTGGGCCAGGATGCTGGCGTACTGCTCGTACGCTGCGGCGATCTCGTCCCGAAGCGGCATCTTGGGGGCGACGCTTGT
CAGGTTCAACTCCGACGTCACACACGTCGCACACGCGTCTTCATCATCTTCATCAGTTGC